G53194 (ubr4)


Basic Information

Item Value
gene id G53194
gene name ubr4
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053116.1
NCBI id CM020913.1
chromosome length 44101041
location 26207689 ~ 26208140 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU71095
CTCCTCTATCAGTTCCTCCATTTGCTTTAACAGTGAGGTCTTGGTCACCACCTGACCTTTCTCATTGGTCGTCATGCCCAGTGTTCCCAGGGCCTTCTGTCTCATGGCCATCGCCATCCGTTTCTTTTCAGATCGGGTCTCTCTGCGGGCGGCATCAATCTTCAGGTTGACATCACTGTGCTCCCTCAGCGCCTCCAGAAGGTTTTCCGCCAGCGTGCCGATGCCTTCGTCACTGGATACCTGCTCCAGCTTGTGCAAGTTGGTTATTGAATCTGTGCCTATCAG

Function

symbol description
ubr4 Predicted to enable ubiquitin-protein transferase activity. Predicted to be involved in ubiquitin-dependent protein catabolic process. Predicted to be active in centrosome; cytosol; and nucleoplasm. Orthologous to human UBR4 (ubiquitin protein ligase E3 component n-recognin 4).

NR:

description
PREDICTED: LOW QUALITY PROTEIN: E3 ubiquitin-protein ligase UBR4

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU71095 True 285 lncRNA 0.53 2 26207689 26208140

Neighbor

gene id symbol gene type direction distance location
LOC120559533 NA coding downstream 88355 26109567 ~ 26119334 (-)
taf10 taf10 coding downstream 106293 26096325 ~ 26101396 (-)
ppih ppih coding downstream 112112 26078812 ~ 26095577 (-)
ybx1 ybx1 coding downstream 131041 26071585 ~ 26076648 (-)
hes2.1 hes2,LOC104926436,LOC103362588 coding downstream 220451 25985681 ~ 25987238 (-)
LOC120558512 LOC108236765 coding upstream 16989 26225129 ~ 26226447 (-)
LOC120559017 NA coding upstream 20750 26228890 ~ 26232414 (-)
LOC120558305 NA coding upstream 68275 26276415 ~ 26286289 (-)
LOC120559019 LOC102791945 coding upstream 78408 26286548 ~ 26315880 (-)
kif5aa LOC103362778,LOC100691451 coding upstream 117750 26325890 ~ 26348279 (-)
G53185 NA non-coding downstream 12518 26194498 ~ 26195171 (-)
G53179 NA non-coding downstream 17975 26185856 ~ 26189714 (-)
G53161 NA non-coding downstream 70858 26134261 ~ 26136831 (-)
G53095 espn non-coding downstream 159276 26035585 ~ 26048413 (-)
LOC120559222 NA non-coding downstream 340167 25832432 ~ 25867522 (-)
G53240 NA non-coding upstream 156180 26364320 ~ 26364799 (-)
G53324 NA non-coding upstream 192863 26401003 ~ 26580105 (-)
G53335 NA non-coding upstream 234942 26443082 ~ 26444898 (-)
G53346 NA non-coding upstream 296309 26504449 ~ 26537256 (-)
G53349 vapb non-coding upstream 320411 26528551 ~ 26533028 (-)
emc1 NA other downstream 60444 26136998 ~ 26147245 (-)
acot7 acot7,LOC102782704 other downstream 235367 25910755 ~ 25972322 (-)
phactr3a LOC100701276,LOC107550338,LOC107551495,LOC104947949,LOC103365918,LOC106955159 other downstream 1422684 24750431 ~ 24785005 (-)
masp2 masp2,LOC106536928,LOC103357864,LOC107086886 other downstream 1868233 24335149 ~ 24339456 (-)
G52501 eno1,LOC104965722,LOC103151087 other downstream 2888005 23308500 ~ 23319684 (-)
G53196 NA other upstream 4853 26212993 ~ 26214882 (-)
LOC120559114 LOC101164642,LOC104966947,LOC100690915,LOC104926428,LOC102195969,LOC101062277 other upstream 183872 26392012 ~ 26402310 (-)
dcp1a dcp1a other upstream 438674 26646814 ~ 26658321 (-)
selenok selenok other upstream 584312 26792452 ~ 26795090 (-)
G53444 sema3g other upstream 753207 26961347 ~ 26966023 (-)

Expression


Co-expression Network