G159333


Basic Information

Item Value
gene id G159333
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030143.1
NCBI id CM030143.1
chromosome length 20516281
location 10759976 ~ 10760189 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU200592
aaacagaaacagctgtgtaggaggaataaaactgggtgaggaacagccaaactcagctaacaaggtgaggctgctgaagacagtttactgtcaaaagtcctacaccatggcaagactgagcacagcaacaagacacaaggtagttctactgcatcagcaaggtctctcccaggcagacaggggtttccagatgtgctgtccaagctcttttgaa

Function

GO:

id name namespace
GO:0002011 morphogenesis of an epithelial sheet biological_process
GO:0060429 epithelium development biological_process
GO:0055113 epiboly involved in gastrulation with mouth forming second biological_process
GO:0090504 epiboly biological_process
GO:0001702 gastrulation with mouth forming second biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU200592 True 214 lncRNA 0.48 1 10759976 10760189

Neighbor

gene id symbol gene type direction distance location
AMCG00001644 rab1a,LOC107676578,LOC103035225,LOC107666439,LOC107601860,LOC105005759,LOC107725478 coding upstream 42294 10709873 ~ 10717682 (+)
AMCG00001646 NA coding upstream 54699 10694966 ~ 10705277 (+)
AMCG00001639 c1d coding upstream 533894 10222565 ~ 10226082 (+)
AMCG00001640 wdr92,LOC107699151,LOC103374796 coding upstream 547902 10208776 ~ 10212074 (+)
AMCG00001641 ppp3r1b,LOC108441257,LOC107594412,LOC107558205,LOC107577029 coding upstream 558041 10199198 ~ 10201935 (+)
AMCG00001657 NA coding downstream 36539 10796728 ~ 10797750 (+)
AMCG00001654 NA coding downstream 91684 10851873 ~ 10870202 (+)
AMCG00001650 peli1b,LOC107583279,LOC107583565,LOC107720901,LOC107670869,LOC107654901 coding downstream 145285 10905474 ~ 10918546 (+)
AMCG00001651 NA coding downstream 159066 10919255 ~ 10937919 (+)
AMCG00001663 NA coding downstream 231889 10992078 ~ 11042644 (+)
G159294 actr2,actr2a,LOC108423375,LOC104930021 non-coding upstream 72540 10684782 ~ 10687436 (+)
G159273 NA non-coding upstream 311230 10441947 ~ 10448746 (+)
G159250 NA non-coding upstream 440832 10315061 ~ 10319144 (+)
G159204 NA non-coding upstream 689642 10069930 ~ 10070334 (+)
G159169 NA non-coding upstream 890373 9869168 ~ 9869603 (+)
G159356 NA non-coding downstream 80908 10841097 ~ 10843834 (+)
G159377 NA non-coding downstream 207145 10967334 ~ 10968401 (+)
G159378 NA non-coding downstream 209212 10969401 ~ 10972090 (+)
G159441 NA non-coding downstream 457130 11217319 ~ 11221908 (+)
G159483 NA non-coding downstream 676473 11436662 ~ 11439612 (+)
AMCG00001645 NA other upstream 2118 10747489 ~ 10757858 (+)
AMCG00001643 spred2 other upstream 82122 10655187 ~ 10677854 (+)
AMCG00001630 NA other upstream 600150 10157734 ~ 10159826 (+)
G159174 NA other upstream 845312 9913308 ~ 9914664 (+)
G158836 NA other upstream 2598161 8159146 ~ 8161815 (+)
AMCG00001691 NA other downstream 1569790 12329979 ~ 12333700 (+)
G160026 NA other downstream 3509426 14269615 ~ 14270190 (+)
AMCG00001760 mpc1,LOC107725004,LOC106589821,LOC107693783 other downstream 4571431 15331620 ~ 15334580 (+)
AMCG00001762 NA other downstream 4672148 15432337 ~ 15439031 (+)
AMCG00001814 ryr2,LOC106456445,LOC108410403,LOC106906861,LOC101062804,LOC103129799 other downstream 5477073 16237262 ~ 16377860 (+)

Expression


Co-expression Network