AMCG00010171



Basic Information


Item Value
gene id AMCG00010171
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030129.1
NCBI id CM030129.1
chromosome length 41163702
location 17345266 ~ 17345562 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>AMCG00010171
ATGGAGATCCTGGCCGGCGCCGCGTTGGTCATCGGGATGTTCCCCCCCTGCCATAGGTGGGAGCAGCGGGACACCCGGGACTCGTGGTCTCCTCGTATCCCCGCGGAACCGGCGCCGAAAGCCAACAACCACCGGGTGAGGAGCAGGCCGCCCATCGACATCGCCAGCATAACCACCCGGTCGGACAGCAGTGTCCCCTACAGAAGGGACTCCCTGGACGACGGAGATTTCCGGGCCCCCAAGAAAATGAACAGACCCCACGTTGTCCGCAATCATCCCGCTGACGCCGACCTGTGA

Function


GO: NA

KEGG:

id description
ko00603 Glycosphingolipid biosynthesis - globo and isoglobo series

RNA


RNA id representative length rna type GC content exon number start site end site
AMCG00010171 True 297 mRNA 0.65 1 17345266 17345562

Neighbor


gene id symbol gene type direction distance location
AMCG00010172 NA coding downstream 1364 17343278 ~ 17343902 (-)
AMCG00010159 rufy3,LOC107553597 coding downstream 131982 17194002 ~ 17213284 (-)
AMCG00010157 mob1b,LOC107746863,LOC103036920,LOC107585392 coding downstream 158328 17168595 ~ 17186938 (-)
AMCG00010156 dck coding downstream 178112 17152905 ~ 17167154 (-)
AMCG00010158 slc4a4 coding downstream 196517 17125229 ~ 17148749 (-)
AMCG00010170 NA coding upstream 7591 17353153 ~ 17353449 (-)
AMCG00010179 NA coding upstream 34626 17380188 ~ 17388056 (-)
AMCG00010178 NA coding upstream 49575 17395137 ~ 17403507 (-)
AMCG00010180 NA coding upstream 94621 17440183 ~ 17452488 (-)
AMCG00010182 NA coding upstream 119550 17465112 ~ 17473608 (-)
G78433 NA non-coding downstream 34749 17310162 ~ 17310517 (-)
G78432 NA non-coding downstream 35295 17309582 ~ 17309971 (-)
G78431 NA non-coding downstream 36350 17308710 ~ 17308916 (-)
G78430 NA non-coding downstream 37000 17307850 ~ 17308266 (-)
G78429 NA non-coding downstream 38265 17306377 ~ 17307001 (-)
G78434 NA non-coding upstream 27239 17372801 ~ 17375304 (-)
G78468 NA non-coding upstream 58844 17404406 ~ 17405317 (-)
G78470 NA non-coding upstream 62429 17407991 ~ 17408199 (-)
G78508 NA non-coding upstream 112382 17457944 ~ 17458473 (-)
G78509 NA non-coding upstream 113327 17458889 ~ 17460504 (-)
AMCG00010169 cnot6l,LOC107752360 other downstream 49751 17282646 ~ 17295515 (-)
AMCG00010142 LOC104932682,LOC108255669 other downstream 1121225 16209319 ~ 16224041 (-)
AMCG00010082 NA other downstream 3875011 13347541 ~ 13470255 (-)
G77544 NA other downstream 5616101 11728503 ~ 11729165 (-)
AMCG00009989 NA other downstream 9023922 8314109 ~ 8321344 (-)
AMCG00010183 stoml2 other upstream 128267 17473829 ~ 17478791 (-)
AMCG00010188 NA other upstream 495145 17840707 ~ 17844389 (-)
AMCG00010190 NA other upstream 507305 17852867 ~ 17855821 (-)
G78610 NA other upstream 599673 17945235 ~ 17945761 (-)
AMCG00010206 NA other upstream 1517706 18863268 ~ 18872082 (-)

Expression



Co-expression Network