AMCG00011407


Basic Information

Item Value
gene id AMCG00011407
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030133.1
NCBI id CM030133.1
chromosome length 32682731
location 22798038 ~ 22798793 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00011407
ATGATCTGCTTTAATAAGTCATGTCTCAGCGTCACTGGCAATGATGAGGACGCCATGTTCGAGAGCATCATCAGAGACCCAGTGCAGTTCCCCAGCCACCTCTCCACAGAAGCCACCTCCATCATCACAGGGCTGTTGGAGAAAGACCCAGAGTGGCGGCTGGGCACCGGGGAGCGCGGAGTGGAGGACGTCAAGGCCCACCCCTTCTTCAGGCGAGCGCGAGGCCCTGTGCAGCTCCGCGGCCCCCGTGTTCACTCTGCCCCACAAGCGCAGGGCCCTGACTGA

Function

GO:

id name namespace
GO:0006351 transcription, DNA-templated biological_process
GO:0050794 regulation of cellular process biological_process
GO:0016310 phosphorylation biological_process
GO:0042995 cell projection cellular_component
GO:0043229 intracellular organelle cellular_component
GO:0000166 nucleotide binding molecular_function
GO:0004674 protein serine/threonine kinase activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00011407 True 285 mRNA 0.61 4 22798038 22798793

Neighbor

gene id symbol gene type direction distance location
AMCG00011406 NA coding upstream 209 22797478 ~ 22797829 (+)
AMCG00011405 NA coding upstream 12096 22752650 ~ 22785942 (+)
AMCG00011404 NA coding upstream 48192 22744521 ~ 22749846 (+)
AMCG00011396 NA coding upstream 106233 22669741 ~ 22691805 (+)
AMCG00011397 LOC108416539,LOC105007475 coding upstream 147204 22646032 ~ 22650834 (+)
AMCG00011402 si:dkey-280e21.3,LOC107664720,LOC107662031 coding downstream 20968 22819761 ~ 22834827 (+)
AMCG00011403 thoc3,LOC102780803 coding downstream 37006 22835799 ~ 22839503 (+)
AMCG00011410 NA coding downstream 441395 23240188 ~ 23262838 (+)
AMCG00011411 glra1 coding downstream 489248 23288041 ~ 23321381 (+)
AMCG00011417 LOC106612256 coding downstream 605063 23403856 ~ 23415142 (+)
G106513 NA non-coding upstream 103194 22692737 ~ 22694844 (+)
G106485 NA non-coding upstream 230777 22564099 ~ 22567261 (+)
G106481 NA non-coding upstream 243548 22554259 ~ 22554490 (+)
G106479 NA non-coding upstream 250631 22547164 ~ 22547407 (+)
G106477 smad1,smad5,LOC107598346 non-coding upstream 253603 22544184 ~ 22544435 (+)
G106586 NA non-coding downstream 63815 22862608 ~ 22862952 (+)
G106588 NA non-coding downstream 130336 22929129 ~ 22935544 (+)
G106607 NA non-coding downstream 408453 23207246 ~ 23207477 (+)
G106609 NA non-coding downstream 554835 23353628 ~ 23355643 (+)
G106619 NA non-coding downstream 557941 23356734 ~ 23361014 (+)
G106242 NA other upstream 2430815 20361208 ~ 20367223 (+)
AMCG00011365 LOC108438827,LOC108243066,LOC107376386 other upstream 2458713 20296011 ~ 20339325 (+)
G106139 LOC108275110 other upstream 2635072 20095229 ~ 20162966 (+)
G105916 NA other upstream 3575617 19222055 ~ 19222421 (+)
AMCG00011328 NA other upstream 3680669 19107273 ~ 19117369 (+)
G106613 NA other downstream 542515 23341308 ~ 23341765 (+)
G106618 NA other downstream 557269 23356062 ~ 23356559 (+)
G106711 zgc:175280,slc7a1,LOC107719755,LOC107702889,LOC107557764,LOC103353344,LOC106563607 other downstream 949881 23748674 ~ 23753002 (+)
AMCG00011430 dctn4,LOC107749746,LOC106604160 other downstream 1037026 23835819 ~ 23844911 (+)
AMCG00011455 unc5a,LOC107677380,LOC107653334 other downstream 2809193 25607986 ~ 25662179 (+)

Expression


Co-expression Network