XLOC_006084 (ptpn20)


Basic Information

Item Value
gene id XLOC_006084
gene name ptpn20
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007124.7
NCBI id CM002897.2
chromosome length 52186027
location 31184796 ~ 31185783 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00012005
TTCTTCTGGCTTCAGTTTGAAACCAGGTGAAATAATCTACATGGAGCTCCGAAAGATCAACGGCAGTTTGGGAATCAGTGTTGCTGGTGGGATCAACACTAATGTACATCATGGAGGAATCTACATCAAAAGTGTGATAGCAGGAGGAGCGGCAGATCAAGATGGAAGAATACAGATAGGTGACAGACTGCTGGAGGTGGACGGATGTAACCTGCGTGCCGTCACACACAGGCAGGCGGTGGAGTGCCTGAAGAGAACCGGAGAG

Function

symbol description
ptpn20 Predicted to enable phosphatidylinositol 3-kinase regulatory subunit binding activity and protein tyrosine phosphatase activity. Predicted to be involved in peptidyl-tyrosine dephosphorylation. Predicted to act upstream of or within bicellular tight junction assembly and protein dephosphorylation. Predicted to be located in cytoskeleton. Predicted to be active in cytoplasm and nucleus.

GO:

id name namespace
GO:0035335 peptidyl-tyrosine dephosphorylation biological_process
GO:0006470 protein dephosphorylation biological_process
GO:0016311 dephosphorylation biological_process
GO:0005856 cytoskeleton cellular_component
GO:0005634 nucleus cellular_component
GO:0005737 cytoplasm cellular_component
GO:0036312 phosphatidylinositol 3-kinase regulatory subunit binding molecular_function
GO:0016787 hydrolase activity molecular_function
GO:0016791 phosphatase activity molecular_function
GO:0004725 protein tyrosine phosphatase activity molecular_function

KEGG:

id description
ko01009 Protein phosphatases and associated proteins

ZFIN:

id description
ZDB-GENE-090313-90 Predicted to enable phosphatidylinositol 3-kinase regulatory subunit binding activity and protein tyrosine phosphatase activity. Predicted to be involved in peptidyl-tyrosine dephosphorylation. Predicted to act upstream of or within bicellular tight junction assembly and protein dephosphorylation. Predicted to be located in cytoskeleton. Predicted to be active in cytoplasm and nucleus.

Ensembl:

ensembl_id ENSDARG00000075459

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00012005 True 265 mRNA 0.49 3 31184796 31185783

Neighbor

gene id symbol gene type direction distance location
XLOC_006083 ptpn20 coding upstream 2252 31182103 ~ 31182544 (+)
XLOC_006082 ptpn20 coding upstream 3786 31180084 ~ 31181010 (+)
XLOC_006081 ptpn20 coding upstream 6260 31177934 ~ 31178536 (+)
XLOC_006080 CR931802.3 coding upstream 9642 31172833 ~ 31175154 (+)
XLOC_006078 arhgap22 coding upstream 45030 31108334 ~ 31139766 (+)
XLOC_006085 ptpn20 coding downstream 6720 31192503 ~ 31196591 (+)
XLOC_006086 ptpn20 coding downstream 19656 31205439 ~ 31228552 (+)
XLOC_006087 gdf10a coding downstream 99877 31285660 ~ 31289625 (+)
XLOC_006088 antxr1d coding downstream 111233 31297016 ~ 31335750 (+)
XLOC_006089 METTL18 coding downstream 204530 31390313 ~ 31392869 (+)
XLOC_006074 NA non-coding upstream 256135 30920554 ~ 30928661 (+)
XLOC_006071 CR762493.1 non-coding upstream 348020 30836656 ~ 30836776 (+)
XLOC_006067 NA non-coding upstream 507153 30676825 ~ 30677643 (+)
XLOC_006065 AL844152.1 non-coding upstream 673073 30511607 ~ 30511723 (+)
XLOC_006063 AL929330.1 non-coding upstream 932939 30251741 ~ 30251857 (+)
XLOC_006101 NA non-coding downstream 620737 31806520 ~ 31850508 (+)
XLOC_006102 NA non-coding downstream 769437 31955220 ~ 31978484 (+)
XLOC_006103 NA non-coding downstream 919482 32105265 ~ 32108472 (+)
XLOC_006105 CR769766.1 non-coding downstream 1206600 32392383 ~ 32392499 (+)
XLOC_006111 CR936241.1 non-coding downstream 1660710 32846493 ~ 32846609 (+)

Expression


Co-expression Network