AMCG00015321 (mrps12)


Basic Information

Item Value
gene id AMCG00015321
gene name mrps12
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030132.1
NCBI id CM030132.1
chromosome length 32980562
location 7826681 ~ 7828114 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00015321
ATGACGTGCACTGTGAAACACTTCCGGGGTCACAGGGAAGGGACTGGGCTCGTACAGTACTCGCTGTCGCCACCTCGGCCCGGTTCTGTGCGTCTCGCAGCCTCAGGTCCAGCCCGGGTCCGGATCACAGCGCGGACACGCCGTGCAGCCGGACAGTCACAGCAGCGCAGAGAACCAGGTTTCGTGGAGACGGAGGGAGCGATGGCGCTTCTCGGCAGTCTGAGGCCGGTGATGTCATCACTCCTGGGGACGGTGCGCAGTGCGGGCAGTGTGGCGGCGCGAGGCATGGCCACTCTGAACCAGCTGCACAGGCAGGGCCGCCCGCGCCCCGAGCCCCCCGGAACCAGCCCCACGTTCGGCCGGCCGCAGCTGAAAGGTGTGATTCTGAAGACCATGATCCGCAAACCCAAGAAGCCCAACTCCGCCAACAGGAAGTGTGCGCGCGTGAGGCTGTCCAACGGCCGCGAGGTGGTGTGCTTCATCCCTGGGGAGGGACACAACCTGCAGGAGCACAACATCGTGCTGGTGGAGGGAGGGCGCACGCAGGACCTGCCGGGGGTCAAGCTGAAGATAGTGCGGGGGAAGTACGACTGCGCACACGTGCAGAAGAAGAAGCAGTGA

Function

symbol description
mrps12 Predicted to be a structural constituent of ribosome. Predicted to be involved in translation. Predicted to be part of small ribosomal subunit. Predicted to be active in ribosome. Orthologous to human MRPS12 (mitochondrial ribosomal protein S12).

NR:

description
PREDICTED: 28S ribosomal protein S12, mitochondrial

GO:

id name namespace
GO:0006412 translation biological_process
GO:0015935 small ribosomal subunit cellular_component
GO:0003735 structural constituent of ribosome molecular_function

KEGG:

id description
K02950 RP-S12, MRPS12, rpsL; small subunit ribosomal protein S12

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00015321 True 621 mRNA 0.65 4 7826681 7828114

Neighbor

gene id symbol gene type direction distance location
AMCG00015320 LOC107707189 coding downstream 921 7821194 ~ 7825760 (-)
AMCG00015314 NA coding downstream 69462 7748342 ~ 7757219 (-)
AMCG00015313 NA coding downstream 116413 7707910 ~ 7710268 (-)
AMCG00015304 NA coding downstream 437121 7386859 ~ 7389560 (-)
AMCG00015303 NA coding downstream 529096 7294862 ~ 7297585 (-)
AMCG00015318 NA coding upstream 5204 7833318 ~ 7834220 (-)
AMCG00015319 NA coding upstream 28965 7857079 ~ 7861747 (-)
AMCG00015329 NA coding upstream 49320 7877434 ~ 7885936 (-)
AMCG00015327 NA coding upstream 60511 7888625 ~ 7897453 (-)
AMCG00015326 NA coding upstream 75464 7903578 ~ 7908926 (-)
G97134 NA non-coding downstream 6492 7819804 ~ 7820189 (-)
G97130 NA non-coding downstream 11279 7814894 ~ 7815402 (-)
G97121 NA non-coding downstream 46083 7780392 ~ 7780598 (-)
G97041 NA non-coding downstream 207164 7497942 ~ 7619517 (-)
G96994 NA non-coding downstream 461682 7362385 ~ 7364999 (-)
G97221 NA non-coding upstream 141483 7969597 ~ 7970757 (-)
G97244 NA non-coding upstream 173372 8001486 ~ 8016073 (-)
G97395 NA non-coding upstream 240666 8068780 ~ 8069037 (-)
G97409 gng3,LOC107559409 non-coding upstream 296154 8124268 ~ 8126464 (-)
G97475 NA non-coding upstream 603809 8431923 ~ 8433316 (-)
G97125 NA other downstream 40239 7786087 ~ 7786442 (-)
AMCG00015305 NA other downstream 378387 7390889 ~ 7448294 (-)
AMCG00015288 NA other downstream 902967 6917679 ~ 6923714 (-)
AMCG00015285 NA other downstream 930254 6891235 ~ 6896427 (-)
AMCG00015283 NA other downstream 948947 6870462 ~ 6877734 (-)
AMCG00015333 nxf1,LOC105897453,LOC108417053,LOC106603139 other upstream 241921 8070035 ~ 8091826 (-)
G97411 NA other upstream 303193 8131307 ~ 8134115 (-)
AMCG00015348 ehd1b,LOC107718765,LOC107720605,LOC106603140,LOC107548869,LOC106930329,LOC103471421,LOC103136898 other upstream 395085 8223199 ~ 8283629 (-)
AMCG00015361 NA other upstream 533500 8361614 ~ 8370031 (-)
G97455 mark2a,LOC107715377 other upstream 581873 8409987 ~ 8411882 (-)

Expression


Co-expression Network