G2827


Basic Information

Item Value
gene id G2827
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000000
NCBI id null
chromosome length 19091038
location 4726988 ~ 4727323 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU3154
TGTTCTTGAATGGCCCAGCCAGAGCCCTGACTTAAACCCAATTGAGCATCTCTGGAGAGACCTAAAAATGGCTGTCCACCAACGTTTACCATCCAACCTGACAGAACTGGAGAGGATCTGCAAGGAGGAATGGCAGAGGATCCCTAAATCCAGGTGTGAAAAACTTGTTGCATCTTTCCCAAAAAGACTCATGGCTGTATTAGATCAAAAGGGTGCTTCTACTAAATACTGAGCAAAGGGTCTGAATACTTAGGACCATGTGATATTTCAGTTTTTCTTTTTTAATAAATCTGCAAAAATGTCAACAATTCTGTGTTTTTCTGTCAATATGGGGTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU3154 True 336 lncRNA 0.37 1 4726988 4727323

Neighbor

gene id symbol gene type direction distance location
CI01000000_04698746_04717749 RAPGEF2 coding upstream 8080 4698041 ~ 4718908 (+)
CI01000000_04661351_04667059 NA coding upstream 59901 4661351 ~ 4667087 (+)
CI01000000_04576065_04586515 ETFDH coding upstream 140107 4576065 ~ 4586881 (+)
CI01000000_04547587_04562715 RXFP1 coding upstream 164151 4547587 ~ 4562837 (+)
CI01000000_04462428_04462831 NA coding upstream 263876 4462428 ~ 4463112 (+)
CI01000000_05008086_05008382 NA coding downstream 280680 5008003 ~ 5008641 (+)
CI01000000_05030001_05137032 FSTL5 coding downstream 302678 5030001 ~ 5137032 (+)
CI01000000_05173896_05177992 QDPRA coding downstream 446573 5173896 ~ 5178085 (+)
CI01000000_05204803_05264985 LDB2, LDB2A coding downstream 477480 5204803 ~ 5264985 (+)
CI01000000_05267332_05282842 TAPT1 coding downstream 540009 5267332 ~ 5283179 (+)
G2850 NA non-coding upstream 621 4725986 ~ 4726482 (+)
G2847 NA non-coding upstream 155394 4571357 ~ 4571594 (+)
G2845 NA non-coding upstream 157051 4569731 ~ 4569937 (+)
G2795 NA non-coding upstream 242173 4484583 ~ 4484815 (+)
G2793 NA non-coding upstream 247794 4478985 ~ 4479194 (+)
G2858 NA non-coding downstream 14053 4741376 ~ 4741768 (+)
G3041 NA non-coding downstream 119350 4846673 ~ 4848642 (+)
G3081 NA non-coding downstream 189816 4917139 ~ 4917501 (+)
G3115 NA non-coding downstream 234119 4961442 ~ 4961673 (+)
G3124 NA non-coding downstream 239665 4966988 ~ 4967270 (+)
G2774 NA other upstream 272756 4453778 ~ 4454232 (+)
G579 NA other upstream 2818180 1767917 ~ 1908808 (+)
G435 NA other upstream 3294134 1425121 ~ 1432854 (+)
G350 NA other upstream 4050051 671842 ~ 676937 (+)
G6811 NA other downstream 5477508 10204831 ~ 10321679 (+)
G6820 NA other downstream 5699900 10427223 ~ 10433018 (+)
G7018 NA other downstream 6251166 10978489 ~ 10980872 (+)
G7153 NA other downstream 6517134 11244457 ~ 11245633 (+)
G7514 NA other downstream 7409199 12136522 ~ 12137008 (+)

Expression


Co-expression Network