G14753


Basic Information

Item Value
gene id G14753
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 3317221 ~ 3317458 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU16499
CTTCCACCAGACCGCCTTCCGTATTCTTCAAAAAGCTTACGCTGTATGTCCTACACCTTCCCTATTCAACTTACGGAACTATAGCAGCGCCAGTTCCGTTTTTTCCATAATCTGAATACGGAAGGCGTTCTGGCGGAAGCTAGATATTTGACTTCATAACTTGTTTAAATATAGATATTTTTTTTTACAAACGCATCGCTTCGCTTCAGAAGGCCTTCATTAACCCCCCGGAGCCGTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU16499 True 238 lncRNA 0.44 1 3317221 3317458

Neighbor

gene id symbol gene type direction distance location
CI01000001_03200059_03206898 NA coding upstream 110225 3199969 ~ 3206996 (+)
CI01000001_03061892_03081206 NA coding upstream 236012 3060940 ~ 3081209 (+)
CI01000001_02838290_02859249 NA coding upstream 457527 2838290 ~ 2859694 (+)
CI01000001_02787356_02792545 KLF15 coding upstream 523970 2785324 ~ 2793251 (+)
CI01000001_02755511_02767404 CPNE9, CPNE5 coding upstream 549496 2754993 ~ 2767725 (+)
CI01000001_03482362_03485979 TMED4.S, TMED4 coding downstream 164904 3482362 ~ 3487253 (+)
CI01000001_03506220_03510588 COQ10A coding downstream 188762 3506220 ~ 3510660 (+)
CI01000001_03593892_03602210 RACGAP1 coding downstream 276434 3593892 ~ 3602260 (+)
CI01000001_03609191_03615121 NA coding downstream 291733 3609191 ~ 3615416 (+)
CI01000001_03618075_03620436 NA coding downstream 300617 3618075 ~ 3621451 (+)
G14752 NA non-coding upstream 787 3316153 ~ 3316434 (+)
G14597 NA non-coding upstream 238718 3078190 ~ 3078503 (+)
G14555 NA non-coding upstream 344137 2972859 ~ 2973084 (+)
G13973 NA non-coding upstream 739407 2577519 ~ 2577814 (+)
G13971 NA non-coding upstream 751914 2564734 ~ 2565307 (+)
CI01000001_03306094_03325686 NA non-coding downstream 8619 3305894 ~ 3327549 (+)
G14762 NA non-coding downstream 37080 3354538 ~ 3354774 (+)
G14765 NA non-coding downstream 41750 3359208 ~ 3359432 (+)
G14769 NA non-coding downstream 51744 3369202 ~ 3369498 (+)
G14770 NA non-coding downstream 52226 3369684 ~ 3369887 (+)
CI01000001_01668334_01670035 CAMK2N1B other upstream 1646217 1667762 ~ 1671167 (+)
G13051 NA other upstream 2272069 1043713 ~ 1045152 (+)
CI01000001_00483853_00488761 VWA1 other upstream 2825164 483853 ~ 488825 (+)
G12614 NA other upstream 3006280 309144 ~ 310941 (+)
G15794 NA other downstream 1743760 5061218 ~ 5064704 (+)
CI01000001_05279884_05287123 NA other downstream 1969291 5279837 ~ 5287698 (+)
G15995 NA other downstream 2394427 5711885 ~ 5714951 (+)
CI01000001_07531945_07539781 NA other downstream 4215114 7531541 ~ 7540586 (+)

Expression


Co-expression Network