G15360


Basic Information

Item Value
gene id G15360
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 4356216 ~ 4356616 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU17160
CTCTATGTAGTGTTAAAGTAACACTGAAGCAGAGTTAAAGTTAATGAGATAATTAAGTGATTAAGTTATGATTGAGCATTAGTGATGAACACCTGCTGTTAACAAGCAGAATCCCTGAAGAGAAACACAATAACTACAAATGACTTTCAGCCACAGCCTTAGATGAAATCAACTGAAGATAAAAGACATTAAATCTCTCAAGATCTGAATAAACAACTCCACAAAAAGCATATTATCTCATTAAATTTAACTCTGATTCAGAGTTATTTTAACTCTATGTAGAGAGGGACCATATGTTCTCTGAGCAGAGTTGATTTAACTCTGGGGATTTTGCTGTGTAGGGTGATATTAAATGACATAAACAGTAATGTAAGATTTTGGATATATTGTCCATCTTTAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU17160 True 401 lncRNA 0.33 1 4356216 4356616

Neighbor

gene id symbol gene type direction distance location
CI01000001_04328211_04330988 NA coding upstream 25164 4327576 ~ 4331052 (+)
CI01000001_04311013_04315588 NA coding upstream 40451 4311013 ~ 4315765 (+)
CI01000001_04296723_04300348 NA coding upstream 55241 4296601 ~ 4300975 (+)
CI01000001_04085864_04225894 PLXNA2 coding upstream 130322 4085864 ~ 4225894 (+)
CI01000001_03983212_04011240 NA coding upstream 344620 3983128 ~ 4011596 (+)
CI01000001_04369131_04373697 SNPHB, SNPH coding downstream 12515 4369131 ~ 4373972 (+)
CI01000001_04422037_04431229 NA coding downstream 65421 4422037 ~ 4432602 (+)
CI01000001_04433559_04437385 NA coding downstream 76943 4433559 ~ 4437450 (+)
CI01000001_04462781_04463560 NA coding downstream 106165 4462781 ~ 4464613 (+)
CI01000001_04543164_04553053 COMMD7 coding downstream 186002 4542618 ~ 4553673 (+)
G15338 NA non-coding upstream 7635 4343888 ~ 4348581 (+)
G15288 NA non-coding upstream 82231 4240551 ~ 4273985 (+)
G15287 NA non-coding upstream 222692 4100122 ~ 4133524 (+)
G15313 NA non-coding upstream 246856 4103809 ~ 4109360 (+)
G15298 NA non-coding upstream 315463 4040302 ~ 4040753 (+)
G15370 NA non-coding downstream 125222 4481838 ~ 4486799 (+)
G15371 NA non-coding downstream 130304 4486920 ~ 4491381 (+)
G15404 NA non-coding downstream 209654 4566270 ~ 4566542 (+)
G15389 NA non-coding downstream 242061 4598677 ~ 4726740 (+)
CI01000001_03618075_03620436 NA other upstream 734765 3618075 ~ 3621451 (+)
CI01000001_01668334_01670035 CAMK2N1B other upstream 2685212 1667762 ~ 1671167 (+)
G13051 NA other upstream 3311064 1043713 ~ 1045152 (+)
CI01000001_00483853_00488761 VWA1 other upstream 3864159 483853 ~ 488825 (+)
G12614 NA other upstream 4045275 309144 ~ 310941 (+)
G15794 NA other downstream 704602 5061218 ~ 5064704 (+)
CI01000001_05279884_05287123 NA other downstream 930133 5279837 ~ 5287698 (+)
G15995 NA other downstream 1355269 5711885 ~ 5714951 (+)
CI01000001_07531945_07539781 NA other downstream 3175956 7531541 ~ 7540586 (+)
G17234 NA other downstream 3675508 8032124 ~ 8032483 (+)

Expression


Co-expression Network