G17137


Basic Information

Item Value
gene id G17137
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 7792204 ~ 7792612 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU19227
AGGCTAGATGCGATTCCTCCATGAAAACATAGAGTCTATGTCATGAAATAGTTACGTGTCGCCTATCAGCAACCTATACACATCCCAATATAAATGCAAAAAAAATGTGATCTTCAAATTCTGAATGAATTAGGCCTATTATGGAAGCCCGTTTCCACCATTAAATAAAAAATTAAAAACCGTAATTGCGACTTTTTATCTCAACATTGTGACTTTTTATCTTGCAATTCTGAATTTTTTTTTCTCACAATTGCGAGTTATAAAGTCACAATTCTGAGATATAAACTCGCAATTGCGAGAAAAAAAGTCAGAATTCTGAGATTAAGTCGCAATTACTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU19227 True 338 lncRNA 0.33 2 7792204 7792612

Neighbor

gene id symbol gene type direction distance location
CI01000001_07678904_07760870 RERE, REREA coding upstream 31334 7678904 ~ 7760870 (+)
CI01000001_07577777_07584809 ENO1, ENO1A, ENOA coding upstream 207395 7577725 ~ 7584809 (+)
CI01000001_07558102_07564471 SLC2A5 coding upstream 227538 7556925 ~ 7564666 (+)
CI01000001_07544981_07548224 GPR157 coding upstream 243498 7544910 ~ 7548706 (+)
CI01000001_07531945_07539781 NA coding upstream 251639 7531541 ~ 7540586 (+)
CI01000001_07811962_07871073 SAMD11 coding downstream 19350 7811962 ~ 7871073 (+)
CI01000001_07908382_07926320 KLHL17 coding downstream 115770 7908382 ~ 7926477 (+)
CI01000001_07935720_07951221 PLEKHN1 coding downstream 143108 7935720 ~ 7951909 (+)
CI01000001_08091363_08093148 AGRN coding downstream 297310 8089922 ~ 8093262 (+)
CI01000001_08113500_08119591 NA coding downstream 320552 8113164 ~ 8119707 (+)
G17106 NA non-coding upstream 96161 7597981 ~ 7696043 (+)
G17116 NA non-coding upstream 216359 7575512 ~ 7575845 (+)
CI01000001_07421548_07447343 RAP1GAP non-coding upstream 284214 7421548 ~ 7447505 (+)
G16997 NA non-coding upstream 285323 7505945 ~ 7506881 (+)
G16961 NA non-coding upstream 300093 7461128 ~ 7492111 (+)
G17103 NA non-coding downstream 81597 7874209 ~ 7906024 (+)
G17177 NA non-coding downstream 170165 7962777 ~ 7963902 (+)
G17233 NA non-coding downstream 235622 8028234 ~ 8030550 (+)
G17236 NA non-coding downstream 242367 8034979 ~ 8035184 (+)
G17216 NA non-coding downstream 245632 8038244 ~ 8038643 (+)
G15995 NA other upstream 2077253 5711885 ~ 5714951 (+)
CI01000001_05279884_05287123 NA other upstream 2502248 5279837 ~ 5287698 (+)
G15794 NA other upstream 2727500 5061218 ~ 5064704 (+)
CI01000001_03618075_03620436 NA other upstream 4170753 3618075 ~ 3621451 (+)
G17234 NA other downstream 239512 8032124 ~ 8032483 (+)
G17353 NA other downstream 1423410 9216022 ~ 9228859 (+)
G17354 NA other downstream 1441851 9234463 ~ 9240677 (+)
CI01000001_09435836_09436037 NA other downstream 1625716 9435836 ~ 9436373 (+)
G18896 NA other downstream 2447288 10239900 ~ 10241492 (+)

Expression


Co-expression Network