G17317


Basic Information

Item Value
gene id G17317
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 8578015 ~ 8578232 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU19442
CAAAAAACAAAATAACGACTTTTCAACAATATCTAGTGATTTCAAAACACTGCTTCGGAGCTTTACGAATCGAATCAGTGGTTCGGAGCTTTAAAGTCACTTAATTTCAGCAGTTTAGCCGTTTGATAGGAGATCTGAATCATTAATTCAAAACAAAAGATCCGTAAAGCTCAGAAGCAGTTTTGAAATCGGCCATCACGAGATGTTGAAAAGTCGTT

Function

NR:

description
unnamed protein product

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU19442 True 218 lncRNA 0.35 1 8578015 8578232

Neighbor

gene id symbol gene type direction distance location
CI01000001_08540376_08551579 CLCNK coding upstream 26290 8539903 ~ 8551725 (+)
CI01000001_08444733_08450428 NA coding upstream 127091 8444733 ~ 8450924 (+)
CI01000001_08427984_08438912 NA coding upstream 138585 8427984 ~ 8439430 (+)
CI01000001_08365139_08380569 PTPN11B coding upstream 197321 8364229 ~ 8380694 (+)
CI01000001_08271059_08344201 AGRN coding upstream 233814 8271059 ~ 8344201 (+)
CI01000001_08667814_08671039 NA coding downstream 89422 8667654 ~ 8671439 (+)
CI01000001_08714618_08721009 NA coding downstream 136386 8714618 ~ 8721182 (+)
CI01000001_08721737_08727450 KANSL2 coding downstream 143505 8721737 ~ 8727787 (+)
CI01000001_08748236_08757869 NCKAP5L coding downstream 170004 8748236 ~ 8758003 (+)
CI01000001_08785318_08810381 FAM132A coding downstream 207086 8785318 ~ 8810381 (+)
G17316 NA non-coding upstream 206 8577469 ~ 8577809 (+)
G17311 NA non-coding upstream 9326 8568403 ~ 8568689 (+)
G17310 NA non-coding upstream 9653 8568131 ~ 8568362 (+)
G17194 NA non-coding upstream 44388 8530523 ~ 8533627 (+)
G17295 NA non-coding upstream 61214 8516257 ~ 8516801 (+)
G17402 NA non-coding downstream 38349 8616581 ~ 8616784 (+)
G17403 NA non-coding downstream 41661 8619893 ~ 8620189 (+)
G17405 NA non-coding downstream 43279 8621511 ~ 8621840 (+)
G17408 NA non-coding downstream 44871 8623103 ~ 8623324 (+)
G17411 NA non-coding downstream 47051 8625283 ~ 8625501 (+)
G17234 NA other upstream 545532 8032124 ~ 8032483 (+)
CI01000001_07531945_07539781 NA other upstream 1037429 7531541 ~ 7540586 (+)
G15995 NA other upstream 2863064 5711885 ~ 5714951 (+)
CI01000001_05279884_05287123 NA other upstream 3288059 5279837 ~ 5287698 (+)
G15794 NA other upstream 3513311 5061218 ~ 5064704 (+)
G17353 NA other downstream 637790 9216022 ~ 9228859 (+)
G17354 NA other downstream 656231 9234463 ~ 9240677 (+)
CI01000001_09435836_09436037 NA other downstream 840096 9435836 ~ 9436373 (+)
G18896 NA other downstream 1661668 10239900 ~ 10241492 (+)
G18873 NA other downstream 1678880 10223879 ~ 10260714 (+)

Expression


Co-expression Network