G35007



Basic Information


Item Value
gene id G35007
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 16560548 ~ 16560776 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU39748
AAGTGGATACAGACAATTGAGACAGAGCGCAACGTGTCATTACTCTGAGAACTATGCCCACTGGAGGGGAACGTAATCGGCGACAGGATATGCTAAAAATGAAACAAAAAAACATTCATTATTTTTAACCAAAAAATGACAAAATCTTTACTGCACACGTAGGCATACTGAGTGTCAGGATCCCACAATTTGCCCATTCTTCCTGCTGATGCTTCACGTCTTATTGCCT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU39748 True 229 lncRNA 0.36 1 16560548 16560776

Neighbor


gene id symbol gene type direction distance location
CI01000004_16459173_16459658 NA coding downstream 99217 16458970 ~ 16461331 (-)
CI01000004_16455194_16455607 NA coding downstream 104578 16455097 ~ 16455970 (-)
CI01000004_16449696_16450112 NA coding downstream 110300 16448416 ~ 16450248 (-)
CI01000004_16202928_16216455 PRMT5 coding downstream 343788 16202850 ~ 16216760 (-)
CI01000004_16183581_16194877 SLC7A8A, SLC7A8B, SLC7A8 coding downstream 365671 16183022 ~ 16194877 (-)
CI01000004_16596848_16599652 NA coding upstream 35700 16596476 ~ 16601205 (-)
CI01000004_16626200_16639382 COPB2 coding upstream 65160 16625936 ~ 16639382 (-)
CI01000004_16641559_16646208 RBP2B coding upstream 80626 16641402 ~ 16646239 (-)
CI01000004_16654485_16672242 RBP1 coding upstream 93672 16654448 ~ 16672310 (-)
CI01000004_16676283_16687164 NA coding upstream 115211 16675987 ~ 16687690 (-)
G34995 NA non-coding downstream 27540 16529442 ~ 16533008 (-)
G34963 NA non-coding downstream 87259 16473061 ~ 16473289 (-)
G34952 NA non-coding downstream 116018 16444293 ~ 16444530 (-)
G34950 NA non-coding downstream 118109 16434975 ~ 16442439 (-)
G34869 NA non-coding downstream 258448 16236890 ~ 16302100 (-)
G34915 NA non-coding upstream 3714 16564490 ~ 16576188 (-)
G35071 NA non-coding upstream 189127 16749903 ~ 16782525 (-)
G35097 NA non-coding upstream 247835 16808611 ~ 16813559 (-)
G35111 NA non-coding upstream 288112 16848888 ~ 16851285 (-)
G34999 NA other downstream 19270 16537195 ~ 16541278 (-)
G34982 NA other downstream 44574 16502725 ~ 16515974 (-)
G34934 NA other downstream 139042 16401745 ~ 16421506 (-)
G34796 NA other downstream 696800 15860613 ~ 15863748 (-)
G35053 NA other upstream 134995 16695771 ~ 16895093 (-)
G35137 NA other upstream 499446 17060222 ~ 17060790 (-)
CI01000004_17313828_17315129 HIGD1A other upstream 752237 17313013 ~ 17315727 (-)

Expression



Co-expression Network