G36486



Basic Information


Item Value
gene id G36486
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000005
NCBI id null
chromosome length 7630583
location 1430750 ~ 1430975 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU41429
GGCGATTTCAAAACGATGCTTCATGAAGCTTCAAAGCTTTACAAATAATTTGTTTCGAATCAGTGGTTCAGAGTGCCAAAATCACATGATTTCAGTAAATGAGGCTTCGTTACGTCATGAGTGTTTTGAAACTTCAATAGTTCATGTGACTTTGGCAGTTTGATATGCGCCCCGAACCACTGAATCAAAACAAATGATTCGTAAAGCTTCGAAGCTTCATGAAGCA

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU41429 True 226 lncRNA 0.38 1 1430750 1430975

Neighbor


gene id symbol gene type direction distance location
CI01000005_01250101_01298320 MYOM2 coding downstream 132430 1248838 ~ 1298320 (-)
CI01000005_00700274_00704932 NA coding downstream 725818 699474 ~ 704932 (-)
CI01000005_00596581_00598577 NA coding downstream 832173 596167 ~ 598577 (-)
CI01000005_00461483_00481276 NA coding downstream 948966 460760 ~ 481784 (-)
CI01000005_00358864_00426242 NA coding downstream 1003753 358848 ~ 426997 (-)
CI01000005_01648294_01654249 OIT3 coding upstream 217016 1647991 ~ 1654249 (-)
CI01000005_01674196_01674495 NA coding upstream 242464 1673439 ~ 1674495 (-)
CI01000005_01677318_01687512 MCU coding upstream 246186 1677161 ~ 1687599 (-)
CI01000005_01723641_01729676 NA coding upstream 292363 1723338 ~ 1730336 (-)
CI01000005_01761513_01769840 NA coding upstream 330212 1761187 ~ 1769851 (-)
G36485 NA non-coding downstream 343 1430153 ~ 1430407 (-)
G36460 NA non-coding downstream 55036 1371703 ~ 1375714 (-)
G36436 NA non-coding downstream 82101 1330295 ~ 1348649 (-)
G36412 NA non-coding downstream 102937 1308341 ~ 1327813 (-)
G36409 NA non-coding downstream 206666 1223672 ~ 1224084 (-)
G36416 NA non-coding upstream 854 1431829 ~ 1433877 (-)
G36494 NA non-coding upstream 11812 1442787 ~ 1502949 (-)
G36567 NA non-coding upstream 115095 1546070 ~ 1546923 (-)
G36536 NA non-coding upstream 182156 1613131 ~ 1616304 (-)
G36614 NA non-coding upstream 186164 1617139 ~ 1617635 (-)
G36049 NA other downstream 387078 1021295 ~ 1043672 (-)
G36628 NA other upstream 232292 1663267 ~ 1664279 (-)
CI01000005_01883894_01899867 NA other upstream 452279 1883222 ~ 1899867 (-)
G38510 NA other upstream 2773870 4204845 ~ 4206208 (-)
G38415 NA other upstream 2950263 4381238 ~ 4401110 (-)
G39515 NA other upstream 4402817 5833792 ~ 5834539 (-)

Expression



Co-expression Network