G38719


Basic Information

Item Value
gene id G38719
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000005
NCBI id null
chromosome length 7630583
location 4541902 ~ 4542173 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU43871
GCCTCGGATCACAGAAGACCTCTGCACTTAAACGGCTGCACAACAACCAAAAGTCTTCAAGGGTTTAGTGGCAGAGCCGTGCTTTCTGATATTGAAAAAGGAAGACCAGGAAAAAGCCCCTCTTCAACTTTCACAGGCTGAAACGGATGATGACAGACAACTGGCCAAAGAGCCTTTAGTGTTTTGCTTACAAATTAAGGATGATATGGACATTTTTCTTAAAGAGTGTCTGGACAAAAAGAGTCTTGGAATTAATTGCATGTTTATGGAGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU43871 True 272 lncRNA 0.43 1 4541902 4542173

Neighbor

gene id symbol gene type direction distance location
CI01000005_04443111_04445092 NA coding downstream 96810 4443053 ~ 4445092 (-)
CI01000005_04401277_04428207 NA coding downstream 113695 4401248 ~ 4428207 (-)
CI01000005_04332499_04357527 XPO5 coding downstream 183045 4332490 ~ 4358857 (-)
CI01000005_04296779_04299727 NA coding downstream 242117 4296209 ~ 4299810 (-)
CI01000005_04161239_04162612 NA coding downstream 378656 4160972 ~ 4163246 (-)
CI01000005_04624198_04638644 NA coding upstream 81823 4623996 ~ 4638644 (-)
CI01000005_04731666_04732248 LHB coding upstream 189415 4731588 ~ 4732248 (-)
CI01000005_04738995_04739378 NA coding upstream 196446 4738619 ~ 4739378 (-)
CI01000005_04751377_04754904 NA coding upstream 208324 4750497 ~ 4754904 (-)
CI01000005_04758130_04802713 ARFGEF3 coding upstream 215894 4758067 ~ 4802713 (-)
G38537 NA non-coding downstream 173895 4366516 ~ 4368007 (-)
G38530 NA non-coding downstream 232728 4308961 ~ 4309174 (-)
G38517 NA non-coding downstream 313337 4226726 ~ 4228565 (-)
G38512 NA non-coding downstream 326364 4215272 ~ 4215538 (-)
G38721 NA non-coding upstream 1164 4543337 ~ 4543809 (-)
G38724 NA non-coding upstream 5623 4547796 ~ 4548225 (-)
G38725 NA non-coding upstream 6428 4548601 ~ 4548844 (-)
G38729 NA non-coding upstream 9592 4551765 ~ 4552030 (-)
G38756 NA non-coding upstream 115645 4657818 ~ 4668634 (-)
G38415 NA other downstream 140792 4381238 ~ 4401110 (-)
G38510 NA other downstream 335694 4204845 ~ 4206208 (-)
CI01000005_01883894_01899867 NA other downstream 2652626 1883222 ~ 1899867 (-)
G36628 NA other downstream 2877623 1663267 ~ 1664279 (-)
G36049 NA other downstream 3498230 1021295 ~ 1043672 (-)
G39515 NA other upstream 1291619 5833792 ~ 5834539 (-)
CI01000005_06481721_06483251 NA other upstream 1938516 6481355 ~ 6483265 (-)
G40487 NA other upstream 2653622 7195795 ~ 7196428 (-)
G40540 NA other upstream 2984048 7526221 ~ 7532148 (-)

Expression


Co-expression Network