CI01000005_04731666_04732248 (LHB)


Basic Information

Item Value
gene id CI01000005_04731666_04732248
gene name LHB
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000005
NCBI id null
chromosome length 7630583
location 4731588 ~ 4732248 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000005_04731666_04732248.mRNA
GATGCTAGTCGTTCGAAACATCCTCCTTCTCTTATTCTGTTTAGTTGTTCTACTAGTATTTGCTCAAAGCTCTTTTCTTCCACCATGTGAGCCGGTTAATGAGACTGTCGCGGTGGAAAAAGAGGGCTGTCCAAAATGTCTGGTGTTTCAGACCACCATCTGCAGTGGCCACTGCCTAACAAAGGAGCCTGTATACAAGAGCCCATTTTCCACTGTCTACCAACACGTGTGCACTTACCGGGACGTCCGCTATGAGACGGTCCGCTTGCCAGACTGTCCCCCCGGGGTGGACCCCCATATCACCTACCCGGTGGCTCTCAGCTGCGACTGCAGCCTCTGCACCATGGACACGTCCGACTGTACCATCGAAAGCCTGCAGCCTGATTTCTGCATGTCTCAGAGAGAGGATTTCCCTGTGTACTAGCCTGTCATCAAACCACAGAGTACGCAAACTCTGCCCACTCTAAATCAGATAAATGTCACATAGATGTATATCAATAAA

Function

symbol description
lhb Enables hormone activity. Acts upstream of or within female gonad development; gamete generation; and sex determination. Predicted to be located in extracellular region. Predicted to be active in cytoplasm and extracellular space. Is expressed in several structures, including endocrine system; female organism; kidney; liver; and male organism. Human ortholog(s) of this gene implicated in hypogonadotropic hypogonadism 23 with or without anosmia. Orthologous to several human genes including LHB (luteinizing hormone subunit beta).

NR:

description
gonadotropic hormone II beta subunit, GTH II-beta

GO:

id name namespace
GO:0005179 hormone activity molecular_function

KEGG:

id description
K08521 LHB; lutropin subunit beta

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000005_04731666_04732248.mRNA True 502 mRNA 0.50 2 4731588 4732248

Neighbor

gene id symbol gene type direction distance location
CI01000005_04624198_04638644 NA coding downstream 92944 4623996 ~ 4638644 (-)
CI01000005_04443111_04445092 NA coding downstream 286496 4443053 ~ 4445092 (-)
CI01000005_04401277_04428207 NA coding downstream 303381 4401248 ~ 4428207 (-)
CI01000005_04332499_04357527 XPO5 coding downstream 372731 4332490 ~ 4358857 (-)
CI01000005_04296779_04299727 NA coding downstream 431803 4296209 ~ 4299810 (-)
CI01000005_04738995_04739378 NA coding upstream 6371 4738619 ~ 4739378 (-)
CI01000005_04751377_04754904 NA coding upstream 18249 4750497 ~ 4754904 (-)
CI01000005_04758130_04802713 ARFGEF3 coding upstream 25819 4758067 ~ 4802713 (-)
CI01000005_04829696_04837047 PSMB1 coding upstream 97350 4829598 ~ 4837232 (-)
CI01000005_04883863_04894229 TNFAIP3 coding upstream 150036 4882284 ~ 4894229 (-)
G38760 NA non-coding downstream 25711 4698427 ~ 4705877 (-)
G38756 NA non-coding downstream 62954 4657818 ~ 4668634 (-)
G38729 NA non-coding downstream 179558 4551765 ~ 4552030 (-)
G38725 NA non-coding downstream 182744 4548601 ~ 4548844 (-)
G38724 NA non-coding downstream 183363 4547796 ~ 4548225 (-)
G38711 NA non-coding upstream 80385 4812633 ~ 4815375 (-)
G38706 NA non-coding upstream 114677 4846925 ~ 4895140 (-)
G38813 NA non-coding upstream 209089 4941337 ~ 4941717 (-)
G38815 NA non-coding upstream 209678 4941926 ~ 4942172 (-)
G38819 NA non-coding upstream 216476 4948724 ~ 4948956 (-)
G38415 NA other downstream 330478 4381238 ~ 4401110 (-)
G38510 NA other downstream 525380 4204845 ~ 4206208 (-)
CI01000005_01883894_01899867 NA other downstream 2842312 1883222 ~ 1899867 (-)
G36628 NA other downstream 3067309 1663267 ~ 1664279 (-)
G36049 NA other downstream 3687916 1021295 ~ 1043672 (-)
G39515 NA other upstream 1101544 5833792 ~ 5834539 (-)
CI01000005_06481721_06483251 NA other upstream 1748441 6481355 ~ 6483265 (-)
G40487 NA other upstream 2463547 7195795 ~ 7196428 (-)
G40540 NA other upstream 2793973 7526221 ~ 7532148 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_005713 lhb coding NC_007124.7 CM002897.2 2523032 ~ 2526033 (+)