G40039


Basic Information

Item Value
gene id G40039
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000005
NCBI id null
chromosome length 7630583
location 7239048 ~ 7239267 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU45379
CTCTGTGCTTAGCTTTTAATTGAGTTTTCCTTACTGATACTAAATCACAATGGCATCAATACAAGTGCTGACCCTGGCCTGTCACAGAGCGTTGACCACTGCATTGCTGATGTTTAGTATCACACTGTGCAGTTCCCTGGTTTGAAAAGACTTAGACATTTAAAAATGTGGATCTAGGAGTCCCACTAATTGAAGCCATGCTGAAGAGCTGTAACCAAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU45379 True 220 lncRNA 0.42 1 7239048 7239267

Neighbor

gene id symbol gene type direction distance location
CI01000005_07179247_07180248 NA coding upstream 58482 7179194 ~ 7180566 (+)
CI01000005_07176040_07176850 NA coding upstream 62078 7175653 ~ 7176970 (+)
CI01000005_07163500_07164501 NA coding upstream 74350 7163432 ~ 7164698 (+)
CI01000005_07159231_07159796 NA coding upstream 79243 7158678 ~ 7159805 (+)
CI01000005_07130117_07133993 NA coding upstream 105009 7128835 ~ 7134039 (+)
CI01000005_07259213_07282404 CH1073-291C23.1, VIT coding downstream 19946 7259213 ~ 7283295 (+)
CI01000005_07297797_07302584 NA coding downstream 58530 7297797 ~ 7302676 (+)
CI01000005_07309292_07309954 NA coding downstream 70025 7309292 ~ 7309954 (+)
CI01000005_07330665_07337161 NA coding downstream 91398 7330665 ~ 7337161 (+)
CI01000005_07337613_07348597 DDX21 coding downstream 98346 7337613 ~ 7348597 (+)
G40035 NA non-coding upstream 5028 7233797 ~ 7234020 (+)
G40005 NA non-coding upstream 93152 7144875 ~ 7145896 (+)
G39943 NA non-coding upstream 211658 7025017 ~ 7027390 (+)
G39906 NA non-coding upstream 300294 6938523 ~ 6938754 (+)
G39865 NA non-coding upstream 477965 6760778 ~ 6761083 (+)
G40048 NA non-coding downstream 9146 7248413 ~ 7248745 (+)
G39962 NA non-coding downstream 44576 7283843 ~ 7284924 (+)
G40078 NA non-coding downstream 84192 7323459 ~ 7323666 (+)
G40079 NA non-coding downstream 87392 7326659 ~ 7326860 (+)
G40081 NA non-coding downstream 123246 7362513 ~ 7362925 (+)
G39930 NA other upstream 240708 6997544 ~ 6998340 (+)
CI01000005_04735429_04736817 COX20 other upstream 2502191 4735346 ~ 4737082 (+)
G37392 NA other upstream 3515545 3722744 ~ 3723503 (+)
G36291 NA other upstream 5578016 1659733 ~ 1661032 (+)
G36223 NA other upstream 5701244 1503143 ~ 1537804 (+)
CI01000005_07600541_07600974 NA other downstream 358722 7600541 ~ 7602964 (+)

Expression


Co-expression Network