CI01000006_01965496_01966308 (NHP2, NOLA2)


Basic Information

Item Value
gene id CI01000006_01965496_01966308
gene name NHP2, NOLA2
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 1965496 ~ 1966354 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000006_01965496_01966308.mRNA
ATGACTAGGGTAAAGAAAGAGAAAACCGGTGAAGAGGAGACAGGGGGAACAGAAAAATCATATCAAGAATTATTAGCTAATATAAACCCAATCGCAAACCCGCTTGCGTCGCGTAAACTAAGCAAAAAGCTCTACAAATGCGTCAAGAAAGCTGCTAAAGTCAAACAGATCCGACGAGGAGTAAAAGAGGTACAGAAGTTTATCAACAAAGGAGAGACTGGTATTGTGGTTTTTGCTGGAGACACTCTTCCCATCGAGGTGTATTGCCATTTACCAATCATGTGTGAAGACCGAAGCCTGCCTTATGCTTATGTTCCATCTAAAGTTGATTTGGGCTCCTCAGCAGGATCCAAACGTCCCACCTGTGTTATCATGATCAAACCGCATGATGAATATAAAGAAGCCTATGATGAGTGTCTGGAGGAAGTCACATCTCTGCCTAAACCAATCTGAGGACACTGGACTTGTGATATATTCAATCATTCTATTAAAAATGAAA

Function

symbol description
nhp2 Predicted to enable box H/ACA snoRNA binding activity. Predicted to be involved in nucleic acid metabolic process. Predicted to act upstream of or within rRNA processing. Predicted to be located in nucleolus. Predicted to be part of box H/ACA snoRNP complex and telomerase holoenzyme complex. Is expressed in several structures, including digestive system; immature eye; midbrain; retina; and segmental plate. Human ortholog(s) of this gene implicated in autosomal recessive dyskeratosis congenita 2. Orthologous to human NHP2 (NHP2 ribonucleoprotein).
nola2 H/ACA ribonucleoprotein complex subunit 2

GO:

id name namespace
GO:0031429 box H/ACA snoRNP complex cellular_component

KEGG:

id description
K11129 NHP2, NOLA2; H/ACA ribonucleoprotein complex subunit 2

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000006_01965496_01966308.mRNA True 499 mRNA 0.41 4 1965496 1966354

Neighbor

gene id symbol gene type direction distance location
CI01000006_01964013_01964347 GRPEL2 coding upstream 1039 1964013 ~ 1964457 (+)
CI01000006_01943602_01960621 AFAP1L1B coding upstream 4875 1943602 ~ 1960621 (+)
CI01000006_01890066_01892979 RAB39BB, RAB39B, RAB39A, RAB39BA coding upstream 72373 1889713 ~ 1893123 (+)
CI01000006_01842317_01859671 NA coding upstream 103662 1842317 ~ 1861834 (+)
CI01000006_01814388_01822488 TNFSF10L3 coding upstream 142625 1814388 ~ 1822871 (+)
CI01000006_02023656_02025259 SLBP2 coding downstream 57302 2023656 ~ 2025744 (+)
CI01000006_02034527_02040359 FAM53C coding downstream 68173 2034527 ~ 2041268 (+)
CI01000006_02043266_02045032 NA coding downstream 76912 2043266 ~ 2045122 (+)
CI01000006_02116526_02125887 ADRA1BA, ADRA1B coding downstream 149564 2115918 ~ 2126120 (+)
CI01000006_02134157_02143363 NA coding downstream 167803 2134157 ~ 2143760 (+)
G41242 NA non-coding upstream 41552 1918932 ~ 1923944 (+)
G41263 NA non-coding upstream 46759 1918405 ~ 1918737 (+)
G41262 NA non-coding upstream 48585 1916634 ~ 1916911 (+)
G41225 NA non-coding upstream 125614 1838142 ~ 1839882 (+)
G41276 NA non-coding downstream 46912 2013266 ~ 2015646 (+)
G41246 NA non-coding downstream 49776 2016130 ~ 2022876 (+)
G41280 NA non-coding downstream 59578 2025932 ~ 2026243 (+)
G41281 NA non-coding downstream 59996 2026350 ~ 2026565 (+)
G41302 NA non-coding downstream 119281 2085635 ~ 2130958 (+)
G41170 NA other upstream 269675 1692065 ~ 1695821 (+)
G40768 NA other upstream 1472470 488407 ~ 493026 (+)
G40767 NA other upstream 1482161 360009 ~ 484185 (+)
G40772 NA other upstream 1486302 475465 ~ 479194 (+)
G41424 NA other downstream 679308 2645662 ~ 2660570 (+)
G41591 NA other downstream 869813 2836167 ~ 2839421 (+)
CI01000006_03734862_03735227 BANF1, BANF1.S, BANF1.L other downstream 1762876 3734554 ~ 3736035 (+)
G41996 NA other downstream 3150852 5117206 ~ 5124149 (+)
G43896 NA other downstream 3803735 5770089 ~ 5771775 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_019703 NA non-coding NC_007132.7 CM002905.2 30401784 ~ 30409204 (-)