G93797 (sh3bp5,sh3bp5b,LOC107588490,LOC107755668,LOC107704986,LOC107705532)


Basic Information

Item Value
gene id G93797
gene name sh3bp5,sh3bp5b,LOC107588490,LOC107755668,LOC107704986,LOC107705532
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035906.1
NCBI id CM008309.1
chromosome length 35377769
location 27267904 ~ 27294570 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU126170
GCTCGGCCAGGGCTATGGTCTCTTTAGCTGCGCGCAGCACCTCAGTGGCCCTCTGGAAGTCTTGCGTTGCCTTCTGGGCCTCCAGCTGAGCCTGCCGAGCCATTCGGCGTGCCTCCCAGTATGGTTTTGAGTCCTCCACTGCCTTGCCAATCTTCTTCACCAGCTCATCCAGCTTCACTGTGGCCTCCACTAACACAGAGCGGAACCTCTGCCTGGCATCCTCCAACTCTGTTTCACATCTGTTGATGTCATCTGTGGACTGATTCAGCTTCTCAAGCTCCCCCTGAATCCTGGGATCCACTTCTTCCTCTTCGCCTGATTCACATTCTTCATCCGACCTGATCTCCTTGTCTGTGTTATCCATTCTCAACCTCAGTGTTTGTGGGAGGTTTTTTTTCGATGACTAGAACTGAAATATCTACCCTATCTTAAATCTCCCCTCTAGCCTTATGTGTCTGCTGTGTCTGCAGAAACATAAAGCTGGGTAGTTAGATAAATAGTCTAGCAGCTCCACCAGTCTCTTTCAGTCGTGAGCTGGATAAATTATTTAGCGCATTCTGTGTCTAAAATGGATTAAATCGGTATAAAAATGTAGTAACGTGTGTCTCTTTCATTCAGCCTCCGTGATCAGACTCCGTGCGTTTCCTCAGACCGCAGCCGTCCAACTGCAACAATCACTGGCGTCAAG

Function

symbol description
sh3bp5b Predicted to enable protein kinase inhibitor activity. Predicted to be involved in intracellular signal transduction and negative regulation of protein tyrosine kinase activity. Predicted to be active in cytoplasm. Is expressed in intermediate cell mass of mesoderm. Orthologous to human SH3BP5 (SH3 domain binding protein 5).
sh3bp5 Enables guanyl-nucleotide exchange factor activity and protein kinase inhibitor activity. Acts upstream of or within intracellular signal transduction. Located in cytoplasmic vesicle membrane and nuclear body.

NR:

description
PREDICTED: SH3 domain-binding protein 5

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU126170 True 688 lncRNA 0.49 4 27267904 27294570

Neighbor

gene id symbol gene type direction distance location
capn7 capn7,LOC107705521,LOC107755679 coding upstream 19120 27225087 ~ 27248784 (+)
nub1 NA coding upstream 51017 27207410 ~ 27216887 (+)
LOC103039637 NA coding upstream 62566 27197914 ~ 27205338 (+)
LOC103037861 scn12ab,LOC108436082,LOC100305061,LOC105894747 coding upstream 454149 26612471 ~ 26813755 (+)
LOC103033764 kcnh2,kcnh2b coding upstream 1021738 25871826 ~ 26246166 (+)
tmem200c tmem200c coding downstream 663308 27957878 ~ 27983782 (+)
LOC103040375 LOC108432756 coding downstream 710628 28005198 ~ 28156592 (+)
zbtb14 zbtb14,LOC107698704 coding downstream 865163 28159733 ~ 28163252 (+)
LOC103043264 LOC107698705,LOC107728997,LOC108276921,LOC108432759 coding downstream 869246 28163816 ~ 28182133 (+)
LOC103040072 LOC108432760 coding downstream 918254 28212824 ~ 28226157 (+)
G93789 NA non-coding upstream 47935 27218225 ~ 27219969 (+)
G93778 NA non-coding upstream 94773 27090069 ~ 27173131 (+)
G93776 NA non-coding upstream 178809 27087939 ~ 27089095 (+)
G93714 exog non-coding upstream 408772 26858740 ~ 26859132 (+)
G93709 NA non-coding upstream 422667 26844562 ~ 26845237 (+)
G93856 NA non-coding downstream 142186 27436756 ~ 27436972 (+)
G93864 NA non-coding downstream 182348 27476918 ~ 27477190 (+)
G93882 NA non-coding downstream 214415 27508985 ~ 27509536 (+)
G93959 NA non-coding downstream 851256 28145826 ~ 28147493 (+)
G93961 NA non-coding downstream 864209 28158779 ~ 28159038 (+)
G93753 NA other upstream 319025 26948463 ~ 26948879 (+)
LOC103034726 LOC108436089 other upstream 875469 26267493 ~ 26392435 (+)
G93185 LOC105900568,LOC101883708 other upstream 1954197 25311877 ~ 25313707 (+)
G93135 NA other upstream 2302460 24914689 ~ 24965444 (+)
G93079 NA other upstream 2559530 24698133 ~ 24708374 (+)
LOC111193309 l3mbtl4,LOC108432753,LOC107698702,LOC107570871,LOC107728988,LOC107653885,LOC106590345 other downstream 624522 27919092 ~ 27939933 (+)
LOC103021747 rheb,LOC107653878,LOC106590380 other downstream 1914708 29209278 ~ 29326025 (+)
LOC103044382 NA other downstream 1956463 29251033 ~ 29346842 (+)
LOC111193374 NA other downstream 1961608 29256178 ~ 29256564 (+)
G94233 NA other downstream 1975733 29270303 ~ 29365656 (+)

Expression


Co-expression Network