G44745


Basic Information

Item Value
gene id G44745
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 6945655 ~ 6963524 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU50862
TGTTTACTGGGGGTCATGTTGCACAAAAGACGTACAAAGACAGAGAAGCAAAACAACTTGTTTTAAAGTGACTTATAAATTAGTTTTGAATTGCCTTGTAACATGAAACATTCAGTATTAAATATTAAAACCCAAATTATGAGAACAATCCCAGTGGGAACTGTAAGCTCCAAAAATGTTAAACAAATTTACATGACAGAATTTATGTAACTGTTCTGACGGAGAACTGCTGTGATTGTGTGGTCGCATTGTACCCTCTAGTGGAGAAAAACATACTATCAACTAGGTTCAACTTTTTCTATGAAAATCAGTAGAAAAGCCTTGTCAGGCAAAATGAACCAACAACTATAAATATTGCACAGCTTTATATAATTACTAGTTATAAAAGACAGTTTGAGTGAAAATAAATGAATACAATAGGTGTACATCTAGACTTCTCTTGACTTAAGTGTGCTTCTTGAAGAAGCCTTTTGCTTAATTCTTTTGAGAAGACCTAGTGAAGAATCTTAAAGGATTAGTTCACTTCAGAATTAAAATTTCCTGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU50862 True 544 lncRNA 0.44 2 6945655 6963524

Neighbor

gene id symbol gene type direction distance location
CI01000006_06898410_06913888 NECTIN3, PVRL3B coding upstream 31709 6898410 ~ 6913946 (+)
CI01000006_06853100_06858970 OR133-7 coding upstream 86222 6852831 ~ 6859433 (+)
CI01000006_06847369_06848340 OR133-1 coding upstream 96944 6846954 ~ 6848711 (+)
CI01000006_06838948_06839904 NA coding upstream 105401 6838775 ~ 6840254 (+)
CI01000006_06825096_06826055 OR133-1 coding upstream 119203 6824949 ~ 6826452 (+)
CI01000006_06987083_06990215 NA coding downstream 23559 6987083 ~ 6990358 (+)
CI01000006_07066344_07070484 FTSJ1 coding downstream 102820 7066344 ~ 7071255 (+)
CI01000006_07072315_07073358 NA coding downstream 108144 7071668 ~ 7073411 (+)
CI01000006_07078406_07080719 NA coding downstream 113428 7076952 ~ 7080930 (+)
CI01000006_07121418_07160572 ANK1 coding downstream 157645 7121169 ~ 7160825 (+)
G44210 NA non-coding upstream 96498 6848942 ~ 6849157 (+)
G44196 NA non-coding upstream 112385 6833001 ~ 6833270 (+)
G44180 NA non-coding upstream 177716 6767432 ~ 6767939 (+)
G44173 NA non-coding upstream 232184 6712699 ~ 6713471 (+)
G44755 NA non-coding downstream 6980 6970504 ~ 6970816 (+)
G44747 NA non-coding downstream 12874 6976398 ~ 6976884 (+)
G44780 NA non-coding downstream 29344 6992868 ~ 6995377 (+)
G44817 NA non-coding downstream 99997 7063521 ~ 7063784 (+)
G44818 NA non-coding downstream 100303 7063827 ~ 7064167 (+)
CI01000006_06122278_06122736 NA other upstream 816980 6122035 ~ 6122751 (+)
CI01000006_06104927_06109730 NA other upstream 836067 6104927 ~ 6109820 (+)
G43896 NA other upstream 1173880 5770089 ~ 5771775 (+)
G41996 NA other upstream 1821506 5117206 ~ 5124149 (+)
CI01000006_03734862_03735227 BANF1, BANF1.S, BANF1.L other upstream 3209677 3734554 ~ 3736035 (+)
CI01000006_07167131_07168925 NA other downstream 203265 7166778 ~ 7168925 (+)
G44872 NA other downstream 392828 7356352 ~ 7387884 (+)
G45178 NA other downstream 658467 7607604 ~ 7683671 (+)
G45265 NA other downstream 920343 7883867 ~ 7920355 (+)
G45336 NA other downstream 1055818 8019342 ~ 8021951 (+)

Expression


Co-expression Network