G44180


Basic Information

Item Value
gene id G44180
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 6767432 ~ 6767939 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU50167
GGTTATGACTATAACCATGGTTCCCTGAGAGAGGGAACGAGACACTGCGTCCCGAAGGGGGCGCTATGGGAACGCCCTCAGCGTGAATGCGTCTGATGCACGTGTGTCAACTAGTCCAATGGCGAGAGTGAACGTCACTGGTGGGTGACGTCACGACCAGGAAAGGATAAATACACATCCGGAAAGACCGGCTTCAGCTTAAATTGCCGAAGCAAATCGATCACAGGAATGCAGGGAGTATGGCAACGCGACGCTGCGTCCCGAAGGGGGCGCTATGGGAACGATATCCCAAAACGCCATAATTCCAAAATGCCTGTCCGTGTGAAACTGTGGCACACTAAGACGAGAGCACTGATGAGCCTGGAGCTGCGTCCAGGTCGAGATATATCATCTCACAACGTGAGTGGCGAGGATCAGCCCACCACATCANNN

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU50167 True 432 lncRNA 0.53 2 6767432 6767939

Neighbor

gene id symbol gene type direction distance location
CI01000006_06658495_06666257 CHRDL2 coding upstream 100934 6658495 ~ 6666498 (+)
CI01000006_06653186_06657164 NA coding upstream 110156 6653186 ~ 6657276 (+)
CI01000006_06598608_06603726 WDR73 coding upstream 163602 6598548 ~ 6603830 (+)
CI01000006_06438579_06447777 ELMOD1 coding upstream 318271 6438579 ~ 6449161 (+)
CI01000006_06432698_06437087 SLC35F2 coding upstream 329840 6432096 ~ 6437592 (+)
CI01000006_06790435_06791964 NA coding downstream 22171 6790110 ~ 6792805 (+)
CI01000006_06800620_06801564 NA coding downstream 32421 6800360 ~ 6801622 (+)
CI01000006_06803516_06806038 NA coding downstream 35087 6803026 ~ 6806214 (+)
CI01000006_06825096_06826055 OR133-1 coding downstream 57010 6824949 ~ 6826452 (+)
CI01000006_06838948_06839904 NA coding downstream 70836 6838775 ~ 6840254 (+)
G44173 NA non-coding upstream 53961 6712699 ~ 6713471 (+)
G44164 NA non-coding upstream 78867 6688327 ~ 6688565 (+)
G44162 NA non-coding upstream 79855 6687319 ~ 6687577 (+)
G44136 NA non-coding upstream 117321 6647874 ~ 6650111 (+)
G44196 NA non-coding downstream 65062 6833001 ~ 6833270 (+)
CI01000006_06847369_06848340 OR133-1 non-coding downstream 79015 6846954 ~ 6848711 (+)
G44210 NA non-coding downstream 81003 6848942 ~ 6849157 (+)
G44745 NA non-coding downstream 177716 6945655 ~ 6963524 (+)
G44755 NA non-coding downstream 202565 6970504 ~ 6970816 (+)
CI01000006_06122278_06122736 NA other upstream 638757 6122035 ~ 6122751 (+)
CI01000006_06104927_06109730 NA other upstream 657844 6104927 ~ 6109820 (+)
G43896 NA other upstream 995657 5770089 ~ 5771775 (+)
G41996 NA other upstream 1643283 5117206 ~ 5124149 (+)
CI01000006_03734862_03735227 BANF1, BANF1.S, BANF1.L other upstream 3031454 3734554 ~ 3736035 (+)
CI01000006_07167131_07168925 NA other downstream 398850 7166778 ~ 7168925 (+)
G44872 NA other downstream 588413 7356352 ~ 7387884 (+)
G45178 NA other downstream 854052 7607604 ~ 7683671 (+)
G45265 NA other downstream 1115928 7883867 ~ 7920355 (+)
G45336 NA other downstream 1251403 8019342 ~ 8021951 (+)

Expression


Co-expression Network