G48067


Basic Information

Item Value
gene id G48067
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 11981856 ~ 11982106 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU54677
CGACATGAGGGTGAGTAATTATTTACACATTTTTGGGTGAACTAACCCCTTTAAAGTCTCAATGTAACAAAAGGAGTGGATTAGCAAAACAAAATAACAAATGTAGGGCGGGTCTTGGTTCAATACGTCAGTCAATGATTGGATGGAAGCAGAGCTGAATGTGAGCTTGCAGTTGATTGTAAAAAGAGGCAGTTTTTTTGTGGATGAAATGATTGGAAAAGTCAGGCATATGTCATCAGAGGGAAGTCTTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU54677 True 251 lncRNA 0.39 1 11981856 11982106

Neighbor

gene id symbol gene type direction distance location
CI01000006_11888383_11923287 NA coding upstream 57466 11888192 ~ 11924390 (+)
CI01000006_11784520_11803562 NA coding upstream 178006 11782031 ~ 11803850 (+)
CI01000006_11751944_11752854 NA coding upstream 228638 11750854 ~ 11753218 (+)
CI01000006_11704767_11714559 WDR34 coding upstream 267195 11704767 ~ 11714661 (+)
CI01000006_11546432_11575289 NSMFA coding upstream 406380 11546432 ~ 11575476 (+)
CI01000006_12092807_12095434 NA coding downstream 110283 12092389 ~ 12095668 (+)
CI01000006_12176092_12189504 NA coding downstream 193986 12176092 ~ 12189828 (+)
CI01000006_12219317_12222975 TPGS2 coding downstream 237211 12219317 ~ 12223117 (+)
CI01000006_12230746_12235389 NA coding downstream 247441 12229547 ~ 12235525 (+)
CI01000006_12242654_12249350 NOP56, NOP56.L coding downstream 260548 12242654 ~ 12249555 (+)
G47948 NA non-coding upstream 104805 11876815 ~ 11877051 (+)
G47916 NA non-coding upstream 143665 11837752 ~ 11838191 (+)
G47912 NA non-coding upstream 147368 11834232 ~ 11834488 (+)
G47390 NA non-coding upstream 191423 11790211 ~ 11790433 (+)
G47333 NA non-coding upstream 261776 11714686 ~ 11720080 (+)
G48146 NA non-coding downstream 23150 12005256 ~ 12005503 (+)
G48113 NA non-coding downstream 121077 12103183 ~ 12118020 (+)
G48119 NA non-coding downstream 161765 12143871 ~ 12157706 (+)
G48214 NA non-coding downstream 245941 12228047 ~ 12228254 (+)
G48086 NA non-coding downstream 277389 12259495 ~ 12261344 (+)
G47318 NA other upstream 343604 11624267 ~ 11638252 (+)
G47159 NA other upstream 460153 11416229 ~ 11521703 (+)
G47145 NA other upstream 1470050 10485358 ~ 10511806 (+)
G46652 NA other upstream 1822605 10156579 ~ 10159251 (+)
G45416 NA other upstream 3147159 8818814 ~ 8834697 (+)
G48094 NA other downstream 295514 12277620 ~ 12279541 (+)
G48081 NA other downstream 394900 12377006 ~ 12384827 (+)

Expression


Co-expression Network