G51552


Basic Information

Item Value
gene id G51552
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 3108463 ~ 3108912 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU58732
TGTCGTTCCACACCCGTAAGACCTTTGTTCATCTTCGGAACACAAATTAAGATATTTTTTAAGAAATCCGAGAGGTATATGACTCATCCATAGACAGAAATATAATCAACACTTTCAAGGTCCAGAAAGGTACTAAGACATCATTAAAACAGTCGACGTGACTGCAGTGGTTCAACCTTAATTTTATAAAGCAACGAGAATACTTTTTGTGCGCAAAAACAAAACAAAAATAACTTTATTAATTATCGTTGGAGTTGTGATGTGGACTCTTGTCGTTCCTAATATTTTTATAACAATTTTTAAAATTATATCTTTATCGTTATAGTTATCGTCCTTGGTGTAAATTGGTCTATCGCTAAGTTCAAAAAACTGTTCCTAACTCCAGGCAAGTTCACACAACTCTATACCACTCACATAGCCTACTCTGTTCTGGAAAGCCGTGAACACAGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU58732 True 450 lncRNA 0.35 1 3108463 3108912

Neighbor

gene id symbol gene type direction distance location
CI01000009_02918681_02973307 KDM6A coding upstream 134511 2918681 ~ 2973952 (+)
CI01000009_02799246_02827589 NA coding upstream 280823 2799031 ~ 2827640 (+)
CI01000009_02713403_02713914 NA coding upstream 394465 2712958 ~ 2713998 (+)
CI01000009_02674026_02678655 NA coding upstream 429717 2673802 ~ 2678746 (+)
CI01000009_02667840_02668883 NA coding upstream 439299 2667442 ~ 2669164 (+)
CI01000009_03123137_03137452 CCDC80 coding downstream 13204 3122116 ~ 3138311 (+)
CI01000009_03145417_03159851 F5 coding downstream 36505 3145417 ~ 3159914 (+)
CI01000009_03164135_03169470 GPR161 coding downstream 53406 3162318 ~ 3170140 (+)
CI01000009_03202999_03207060 MPC2, MPC2.S coding downstream 93295 3202207 ~ 3208984 (+)
CI01000009_03211734_03220047 NXPE3 coding downstream 102822 3211734 ~ 3222297 (+)
G51553 NA non-coding upstream 452 3107726 ~ 3108011 (+)
G51539 NA non-coding upstream 26053 3081929 ~ 3082410 (+)
G51537 NA non-coding upstream 32083 3076142 ~ 3076380 (+)
G51531 NA non-coding upstream 44031 3064200 ~ 3064432 (+)
G51527 NA non-coding upstream 53451 3054332 ~ 3055012 (+)
G51558 NA non-coding downstream 8946 3117858 ~ 3118356 (+)
G51559 NA non-coding downstream 9881 3118793 ~ 3119020 (+)
G51610 NA non-coding downstream 10552 3119464 ~ 3149432 (+)
G51589 NA non-coding downstream 113847 3222759 ~ 3223865 (+)
G51529 NA other upstream 45876 3062033 ~ 3062587 (+)
G51274 NA other upstream 757977 2255099 ~ 2350486 (+)
CI01000009_01897343_01919208 PIKFYVE other upstream 1207037 1897343 ~ 1919516 (+)
G51122 NA other upstream 1426497 1680146 ~ 1681966 (+)
CI01000009_01431700_01434463 NA other upstream 1670108 1429873 ~ 1435328 (+)
G53388 NA other downstream 2413330 5522242 ~ 5540638 (+)
CI01000009_05931829_05943829 KCNH3 other downstream 2751390 5931718 ~ 5943899 (+)
G53651 NA other downstream 3136652 6245564 ~ 6248392 (+)
G56100 NA other downstream 6020388 9129300 ~ 9130286 (+)

Expression


Co-expression Network