G51537


Basic Information

Item Value
gene id G51537
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 3076142 ~ 3076380 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU58716
GTCGACTTTAACGTTTAAAATTACATGCAACAAGCATCAGACAATGCAAAGGGAGGAAAGTCCAAGTCTCTGCCGACATGTAAAAATACATCAATGCCGTTGACACGTTCTAAATTCTGGGGGCAACATGTAGCAACAAAGAACACCTGGGTGAATCATACAGAGAGAAATTGGTCTGACATTTCACAGTGATGAGCTAACAGCTCTTGATAAGTGAAAAGCTTTTGCATACATTAGCG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU58716 True 239 lncRNA 0.48 1 3076142 3076380

Neighbor

gene id symbol gene type direction distance location
CI01000009_02918681_02973307 KDM6A coding upstream 102190 2918681 ~ 2973952 (+)
CI01000009_02799246_02827589 NA coding upstream 248502 2799031 ~ 2827640 (+)
CI01000009_02713403_02713914 NA coding upstream 362144 2712958 ~ 2713998 (+)
CI01000009_02674026_02678655 NA coding upstream 397396 2673802 ~ 2678746 (+)
CI01000009_02667840_02668883 NA coding upstream 406978 2667442 ~ 2669164 (+)
CI01000009_03123137_03137452 CCDC80 coding downstream 45736 3122116 ~ 3138311 (+)
CI01000009_03145417_03159851 F5 coding downstream 69037 3145417 ~ 3159914 (+)
CI01000009_03164135_03169470 GPR161 coding downstream 85938 3162318 ~ 3170140 (+)
CI01000009_03202999_03207060 MPC2, MPC2.S coding downstream 125827 3202207 ~ 3208984 (+)
CI01000009_03211734_03220047 NXPE3 coding downstream 135354 3211734 ~ 3222297 (+)
G51531 NA non-coding upstream 11710 3064200 ~ 3064432 (+)
G51527 NA non-coding upstream 21130 3054332 ~ 3055012 (+)
G51525 NA non-coding upstream 24778 3050909 ~ 3051364 (+)
G51523 NA non-coding upstream 26034 3049792 ~ 3050108 (+)
G51522 NA non-coding upstream 29043 3046149 ~ 3047099 (+)
G51539 NA non-coding downstream 5549 3081929 ~ 3082410 (+)
G51553 NA non-coding downstream 31346 3107726 ~ 3108011 (+)
G51552 NA non-coding downstream 32083 3108463 ~ 3108912 (+)
G51558 NA non-coding downstream 41478 3117858 ~ 3118356 (+)
G51559 NA non-coding downstream 42413 3118793 ~ 3119020 (+)
G51529 NA other upstream 13555 3062033 ~ 3062587 (+)
G51274 NA other upstream 725656 2255099 ~ 2350486 (+)
CI01000009_01897343_01919208 PIKFYVE other upstream 1174716 1897343 ~ 1919516 (+)
G51122 NA other upstream 1394176 1680146 ~ 1681966 (+)
CI01000009_01431700_01434463 NA other upstream 1637787 1429873 ~ 1435328 (+)
G53388 NA other downstream 2445862 5522242 ~ 5540638 (+)
CI01000009_05931829_05943829 KCNH3 other downstream 2783922 5931718 ~ 5943899 (+)
G53651 NA other downstream 3169184 6245564 ~ 6248392 (+)
G56100 NA other downstream 6052920 9129300 ~ 9130286 (+)

Expression


Co-expression Network