G67156


Basic Information

Item Value
gene id G67156
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000010
NCBI id null
chromosome length 12265998
location 8942592 ~ 8942826 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU76511
GTTTTGTTGCTGATTTGAAATATGTTATTTAATTGTGTGTTCGCCAAGCACTTTTTGAGATTTCAGGATTACCCCATTCAAATAGATAGGACTTGGTCTTGGATGCCCGAAATAGCTGCCCGGAGGCTTTGCAAATATGGCCGCCGAGTGAACAGACTTTTCTCGAAACTGAGGACTTGACTACATGCATCTTGTGGAAGAACGTTGTAGCCACCTAGCCGGAGGTACTCCTTTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU76511 True 235 lncRNA 0.44 1 8942592 8942826

Neighbor

gene id symbol gene type direction distance location
CI01000010_08878920_08926849 GRM7, GRM6A coding downstream 14894 8878829 ~ 8927698 (-)
CI01000010_08846524_08862740 USP11 coding downstream 79852 8845905 ~ 8862740 (-)
CI01000010_08836289_08837480 UXT coding downstream 105112 8836153 ~ 8837480 (-)
CI01000010_08821963_08829108 ELK1 coding downstream 113484 8820471 ~ 8829108 (-)
CI01000010_08780538_08783770 NA coding downstream 158822 8780271 ~ 8783770 (-)
CI01000010_08953769_08962470 COMTA coding upstream 10610 8953436 ~ 8962470 (-)
CI01000010_08997972_08998532 NA coding upstream 54151 8996977 ~ 8998956 (-)
CI01000010_09008474_09031335 SRPK3 coding upstream 65202 9008028 ~ 9031335 (-)
CI01000010_09037913_09074257 PLXNB3 coding upstream 95047 9037873 ~ 9074257 (-)
CI01000010_09130092_09150003 ABCD1 coding upstream 187180 9130006 ~ 9150198 (-)
G67113 NA non-coding downstream 213171 8634018 ~ 8729421 (-)
G66992 NA non-coding downstream 535847 8404540 ~ 8406745 (-)
G66984 NA non-coding downstream 543852 8398519 ~ 8398740 (-)
G66980 NA non-coding downstream 553110 8389192 ~ 8389482 (-)
G66968 NA non-coding downstream 577383 8364466 ~ 8365209 (-)
G67262 NA non-coding upstream 145059 9087885 ~ 9088109 (-)
G67265 NA non-coding upstream 146749 9089575 ~ 9089829 (-)
G67213 NA non-coding upstream 208695 9151521 ~ 9153635 (-)
G67247 NA non-coding upstream 425424 9368250 ~ 9522516 (-)
G67311 NA non-coding upstream 576202 9519028 ~ 9519249 (-)
G67099 NA other downstream 267695 8641690 ~ 8674897 (-)
CI01000010_07880416_07900104 NA other downstream 1044474 7880375 ~ 7900104 (-)
G65453 NA other downstream 1270249 7659435 ~ 7672343 (-)
G64918 NA other downstream 2846112 6093689 ~ 6096480 (-)
G64877 NA other downstream 3025581 5916257 ~ 5917011 (-)
CI01000010_11929215_11933223 DYNLL6, DYNLL1, DYNLL2A, DYNLL2, DYL1, DYNLL1.S, BRAFLDRAFT_130244, DYNLL1.L other upstream 2986135 11928448 ~ 11933343 (-)
CI01000010_11965317_11969111 NA other upstream 3022039 11964865 ~ 11969710 (-)

Expression


Co-expression Network