G66980


Basic Information

Item Value
gene id G66980
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000010
NCBI id null
chromosome length 12265998
location 8389192 ~ 8389482 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU76316
TGCTGTAGAGGTGTGTGCTATTTTGACCCAGAAAAACCCTAGAAACAAAATAGTGATGCCTACTCAGAAAAACCCTAGTAATCACCCAGAACACCTTACAAACCACATAGCAATGCCCTAGCAACCACCCAGAATATCTTAGAAACTACCTAGAAATGCCCTAGCAACCACCCAGAACATCTCAGCAACCACCTAGCAACACACCCAAGCAACCACTTAGAATAGCTTAGCAACACCCTGGCAACCACTCACAACACCCTAGCATTCTGGCGCTGACTTTTCCTTCCACTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU76316 True 291 lncRNA 0.46 1 8389192 8389482

Neighbor

gene id symbol gene type direction distance location
CI01000010_08381760_08382057 NA coding downstream 6869 8381453 ~ 8382323 (-)
CI01000010_08341936_08349855 NA coding downstream 39312 8341359 ~ 8349880 (-)
CI01000010_08293951_08338893 GRIPAP1 coding downstream 50299 8293670 ~ 8338893 (-)
CI01000010_08187103_08253432 KCND1 coding downstream 135239 8187061 ~ 8253953 (-)
CI01000010_08159110_08177308 NA coding downstream 211884 8159100 ~ 8177308 (-)
CI01000010_08586563_08587030 NA coding upstream 196975 8586457 ~ 8587030 (-)
CI01000010_08624504_08629844 PNCK coding upstream 234860 8624342 ~ 8629844 (-)
CI01000010_08694007_08717153 BCAP31 coding upstream 304509 8693991 ~ 8717153 (-)
CI01000010_08725595_08733769 SLC35A2 coding upstream 335485 8724967 ~ 8733769 (-)
CI01000010_08740418_08742300 PIM2 coding upstream 349904 8739386 ~ 8742300 (-)
G66968 NA non-coding downstream 23983 8364466 ~ 8365209 (-)
G66915 NA non-coding downstream 98266 8288166 ~ 8290926 (-)
G66955 NA non-coding downstream 110519 8278470 ~ 8278673 (-)
G65588 NA non-coding downstream 256119 8132841 ~ 8133073 (-)
G65570 NA non-coding downstream 309614 8079248 ~ 8079578 (-)
G66984 NA non-coding upstream 9037 8398519 ~ 8398740 (-)
G66992 NA non-coding upstream 15058 8404540 ~ 8406745 (-)
G67113 NA non-coding upstream 244536 8634018 ~ 8729421 (-)
G67156 NA non-coding upstream 553110 8942592 ~ 8942826 (-)
G67262 NA non-coding upstream 698403 9087885 ~ 9088109 (-)
CI01000010_07880416_07900104 NA other downstream 491074 7880375 ~ 7900104 (-)
G65453 NA other downstream 716849 7659435 ~ 7672343 (-)
G64918 NA other downstream 2292712 6093689 ~ 6096480 (-)
G64877 NA other downstream 2472181 5916257 ~ 5917011 (-)
G64564 NA other downstream 3146266 5049155 ~ 5242926 (-)
G67099 NA other upstream 252208 8641690 ~ 8674897 (-)
CI01000010_11929215_11933223 DYNLL6, DYNLL1, DYNLL2A, DYNLL2, DYL1, DYNLL1.S, BRAFLDRAFT_130244, DYNLL1.L other upstream 3539479 11928448 ~ 11933343 (-)
CI01000010_11965317_11969111 NA other upstream 3575383 11964865 ~ 11969710 (-)

Expression


Co-expression Network