G85346


Basic Information

Item Value
gene id G85346
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 10939342 ~ 10939904 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU97138
TGGGCATTGAAAAAGGAGTGTTATTGCTGGTGATGCAGGCCACACTGAGCCATCGGATTTTATCAAAAATATCTTAATTTGTGTTCCGAAGATGAACGAAGGTCTTACAGGTGTAGAACGACATGAGGGTGAGTAATATATGACATAATTTTCATTTTTGGGTGAACTAACCCTCTAACATAAATTATAAAAACTTTGCAAACTGTGACTAGTACACACACTGAATCCTCCTGAAGTATTATGACTACTATGATTCAGTTTTGAACATAGCCAGCCACACAAACACCTATTCCACCAAGAGACACTTCCACACCCCAACACATATGCTTAAAGCATTGCTGTCCAATCTACACCATCACAACTCTGTCAACATCCTCACATTTTAAATGCCAGCTTTACGATAGCATGCATGCGTATATGACTCTATCCAGCCCCTGCGGCTCTCATCTGCTCTAAAAATTAAACACTCATTAAAATCATGTTTGTGTTGAAGTCAATGTGCAACATAATTACAGCTAAGAGACATACACCAAGCACATGAGTAATATCCCTGCCGATCATCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU97138 True 563 lncRNA 0.39 1 10939342 10939904

Neighbor

gene id symbol gene type direction distance location
CI01000013_10892125_10899628 ARSA coding downstream 39714 10891714 ~ 10899628 (-)
CI01000013_10843295_10852581 CHKB coding downstream 86761 10843160 ~ 10852581 (-)
CI01000013_10838711_10841053 NA coding downstream 97778 10838497 ~ 10841564 (-)
CI01000013_10828622_10836409 CPT1, CPT1B coding downstream 102196 10828531 ~ 10837146 (-)
CI01000013_10799938_10806858 PRPF18 coding downstream 132484 10798598 ~ 10806858 (-)
CI01000013_11262983_11266454 RABL2B coding upstream 322571 11262475 ~ 11266454 (-)
CI01000013_11276658_11278225 NA coding upstream 336730 11276634 ~ 11278730 (-)
CI01000013_11280259_11284882 NA coding upstream 340280 11280184 ~ 11284882 (-)
CI01000013_11308893_11311699 ARF4A, ARF5, ARF4 coding upstream 367891 11307795 ~ 11311699 (-)
CI01000013_11343431_11351259 NA coding upstream 402669 11342573 ~ 11351811 (-)
G85345 NA non-coding downstream 2686 10936381 ~ 10936656 (-)
G85343 NA non-coding downstream 38631 10900487 ~ 10900711 (-)
G85311 NA non-coding downstream 163129 10773780 ~ 10776213 (-)
G85262 NA non-coding downstream 178855 10756812 ~ 10760487 (-)
G85201 NA non-coding downstream 254779 10621530 ~ 10684563 (-)
G85347 NA non-coding upstream 656 10940560 ~ 10940887 (-)
G85348 NA non-coding upstream 1177 10941081 ~ 10941502 (-)
G85349 NA non-coding upstream 3743 10943647 ~ 10943869 (-)
G85351 NA non-coding upstream 5521 10945425 ~ 10945631 (-)
G85353 NA non-coding upstream 7285 10947189 ~ 10947400 (-)
G85188 NA other downstream 344005 10592204 ~ 10595337 (-)
CI01000013_10564288_10569141 NA other downstream 366902 10563459 ~ 10569290 (-)
G85170 NA other downstream 458642 10479861 ~ 10480700 (-)
CI01000013_09309438_09335834 MICAL3A other downstream 1616498 9307036 ~ 9336077 (-)
CI01000013_07339918_07367774 NA other downstream 3556982 7339709 ~ 7367774 (-)
G85401 NA other upstream 95128 11035032 ~ 11035466 (-)
CI01000013_11596784_11604320 NA other upstream 659156 11596688 ~ 11604865 (-)

Expression


Co-expression Network