G87249


Basic Information

Item Value
gene id G87249
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000015
NCBI id null
chromosome length 8631711
location 1009372 ~ 1009607 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU99351
AAATTACCTGTTGAAGAAGAGTGTTCTGTCCTGTTGGATAGCCAGGTTGTGTTTCTCGTTCATATACGATGCAACTTTTTGTATGGAAGAAAACAGGAAGAAAAGCACTTTTGCTAAGATACTGCCTAAGAGATTTATCATTTATGCCGTCCAGCGATTTTCACTTGCACTTATCAGAGAATTATTAGGAAGGTAGGTAGTTGACGTTAATGGAGGAATTTGCAGCTTTACTCGCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU99351 True 236 lncRNA 0.39 1 1009372 1009607

Neighbor

gene id symbol gene type direction distance location
CI01000015_00970175_00973727 NA coding upstream 35632 970175 ~ 973740 (+)
CI01000015_00890625_00902801 CP coding upstream 106376 890625 ~ 902996 (+)
CI01000015_00886425_00888351 TM4SF18 coding upstream 120566 885231 ~ 888806 (+)
CI01000015_00800582_00853181 WWTR1 coding upstream 156191 800582 ~ 853181 (+)
CI01000015_00790715_00793401 COMMD2 coding upstream 214711 790440 ~ 794661 (+)
CI01000015_01015968_01016675 NA coding downstream 6016 1015623 ~ 1017700 (+)
CI01000015_01020856_01025441 HOGA1 coding downstream 11249 1020856 ~ 1025653 (+)
CI01000015_01080504_01101091 NA coding downstream 70897 1080504 ~ 1101383 (+)
CI01000015_01288157_01300925 NA coding downstream 278550 1288157 ~ 1301131 (+)
CI01000015_01307849_01327079 SRFA, SRF coding downstream 297364 1306824 ~ 1328376 (+)
CI01000015_01002365_01011214 HYKK non-coding upstream 595 1002365 ~ 1011275 (+)
G87246 NA non-coding upstream 7913 1001241 ~ 1001459 (+)
G86933 NA non-coding upstream 352646 656227 ~ 656726 (+)
G86932 NA non-coding upstream 353225 655932 ~ 656147 (+)
G86931 NA non-coding upstream 353450 655318 ~ 655922 (+)
G87253 NA non-coding downstream 3977 1013584 ~ 1013801 (+)
G87258 NA non-coding downstream 21830 1031437 ~ 1031846 (+)
G87261 NA non-coding downstream 27091 1036698 ~ 1037314 (+)
G87267 NA non-coding downstream 40655 1050262 ~ 1050542 (+)
G87432 NA other downstream 601476 1611083 ~ 1611387 (+)
G87972 NA other downstream 866397 1876004 ~ 1876594 (+)
G88172 NA other downstream 1374409 2384016 ~ 2526510 (+)
CI01000015_02512276_02523824 NA other downstream 1502491 2511546 ~ 2524572 (+)
CI01000015_03011472_03026518 NA other downstream 2013389 3011472 ~ 3026636 (+)

Expression


Co-expression Network