G103385


Basic Information

Item Value
gene id G103385
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000018
NCBI id null
chromosome length 7078422
location 1958263 ~ 1958519 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU117613
ATGAGGTCATTAGCTTGCTGATTTCTGTTTAAACAATGAGGAATTTTCATTGCGGTTTTCATGAATGTCTTAAAATAATACACAATGCACAAAATTGGTTCTGATTTTCCTACTTTACTTTTAAATGTTTACAACTTGTTCTTAGAGCATCTGTAGTCATTATTTTTTCTGTTTCGGGGTTATCTCAGGCTCAGGATGATTGAGGTCATTTTGTTCTGATTATGAGCGAAAGGAAGCTGACTCCATTTATTATTCGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU117613 True 257 lncRNA 0.34 1 1958263 1958519

Neighbor

gene id symbol gene type direction distance location
CI01000018_01900038_01904335 NA coding upstream 53857 1900038 ~ 1904406 (+)
CI01000018_01821013_01821973 NA coding upstream 135919 1820378 ~ 1822344 (+)
CI01000018_01815173_01819759 NA coding upstream 138246 1815173 ~ 1820017 (+)
CI01000018_01709643_01800520 NETO1, NETO1L coding upstream 157743 1709643 ~ 1800520 (+)
CI01000018_01588236_01598892 NA coding upstream 359013 1588033 ~ 1599250 (+)
CI01000018_02072273_02080049 CCT5.S, CCT5B, TCPE, CCT5 coding downstream 113714 2072233 ~ 2080153 (+)
CI01000018_02104142_02113293 EIF2S3L, EIF2S3.S, IF2G, EIF2S3Y, EIF2S3X, EIF2S3 coding downstream 145184 2103703 ~ 2113546 (+)
CI01000018_02115961_02124173 ZFX coding downstream 157442 2115961 ~ 2124841 (+)
CI01000018_02150486_02181595 PIP4K2AA, PIP4K2AB, PIP4K2A coding downstream 191967 2150486 ~ 2181619 (+)
CI01000018_02203236_02203803 NA coding downstream 243754 2202273 ~ 2204218 (+)
G103384 NA non-coding upstream 245 1957789 ~ 1958018 (+)
G103383 NA non-coding upstream 734 1957029 ~ 1957529 (+)
G103382 NA non-coding upstream 1349 1956598 ~ 1956914 (+)
G103375 NA non-coding upstream 70813 1887186 ~ 1887450 (+)
G103330 NA non-coding upstream 270514 1687452 ~ 1687749 (+)
G103386 NA non-coding downstream 1181 1959700 ~ 1959986 (+)
G103347 NA non-coding downstream 124587 2083106 ~ 2083310 (+)
G103363 NA non-coding downstream 175656 2134175 ~ 2136567 (+)
G103457 NA non-coding downstream 347321 2305840 ~ 2306113 (+)
G103478 NA non-coding downstream 419403 2377922 ~ 2378138 (+)
G102895 NA other upstream 372601 1582913 ~ 1585662 (+)
CI01000018_01924489_01985310 SEMA5A other downstream 10733 1924489 ~ 1985311 (+)
G104258 NA other downstream 1732570 3691089 ~ 3691519 (+)
CI01000018_04368179_04375192 NA other downstream 2411667 4368179 ~ 4375866 (+)
G104670 NA other downstream 2797282 4755801 ~ 4759768 (+)
CI01000018_05217404_05218896 NA other downstream 3258161 5216452 ~ 5222616 (+)

Expression


Co-expression Network