G116217


Basic Information

Item Value
gene id G116217
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000021
NCBI id null
chromosome length 7014339
location 2250984 ~ 2251285 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU131983
GAGTACTCAGTCTCCAGAGTGCTTCAGTCTCACTCTGTAGTTCCTAGGTTGAGTAGGTTGCTCCCCTCTTTCAGGGTCTAAAGCAATTTGCTGAGCTCTACTCCCAGGGGTGCCCATCTCTGGTCCGGTGAGTTCGGTACTGCCTCTTTGCAGTCCCTCTCACAGGATTTTCCTCTCTGAGGAAGTTTGCAGAGATTCTGTTCTTTCAGACAGGTTGTTGGCCTGACTAGCCCTTGGCTGGGCTGGTTCGGCCTCCCTGGTGGCCCTTGGGGTTGACTTTTGTCCCCCTGGTAAGTGACTGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU131983 True 302 lncRNA 0.54 1 2250984 2251285

Neighbor

gene id symbol gene type direction distance location
CI01000021_01977248_01980449 NA coding upstream 270478 1976939 ~ 1980506 (+)
CI01000021_01771612_01785627 EXOSC10 coding upstream 465318 1771389 ~ 1785666 (+)
CI01000021_01717640_01718394 NA coding upstream 532105 1717640 ~ 1718879 (+)
CI01000021_01519982_01528860 GSS coding upstream 721879 1519982 ~ 1529105 (+)
CI01000021_01506852_01513139 BIRC7 coding upstream 737678 1506216 ~ 1513306 (+)
CI01000021_02269000_02272309 NA coding downstream 17404 2268689 ~ 2272396 (+)
CI01000021_02322467_02328819 SNX21 coding downstream 71182 2322467 ~ 2329864 (+)
CI01000021_02331361_02334546 NA coding downstream 79865 2331150 ~ 2334622 (+)
CI01000021_02346223_02369457 NA coding downstream 94720 2346005 ~ 2371089 (+)
CI01000021_02378299_02383589 NA coding downstream 126759 2378044 ~ 2383760 (+)
G116216 NA non-coding upstream 2454 2248266 ~ 2248530 (+)
G116185 NA non-coding upstream 40281 2210464 ~ 2210703 (+)
G116167 NA non-coding upstream 71432 2179160 ~ 2179552 (+)
G116163 NA non-coding upstream 74999 2175781 ~ 2175985 (+)
G115844 NA non-coding upstream 237937 2011030 ~ 2013047 (+)
G116231 NA non-coding downstream 34091 2285376 ~ 2285643 (+)
G116245 NA non-coding downstream 46050 2297335 ~ 2297567 (+)
G116246 NA non-coding downstream 55115 2306400 ~ 2306639 (+)
G116253 NA non-coding downstream 100236 2351521 ~ 2351780 (+)
G116243 NA non-coding downstream 153972 2405257 ~ 2408394 (+)
CI01000021_01332646_01333910 NA other upstream 916575 1331665 ~ 1333951 (+)
G115519 NA other upstream 1767020 480530 ~ 483964 (+)
G116236 NA other downstream 38532 2289817 ~ 2297195 (+)
G117237 NA other downstream 986569 3237854 ~ 3243364 (+)
G117202 NA other downstream 1017859 3269144 ~ 3328233 (+)
G117484 NA other downstream 1704861 3956146 ~ 3957752 (+)
G117493 NA other downstream 1781715 4033000 ~ 4035676 (+)

Expression


Co-expression Network