G123996



Basic Information


Item Value
gene id G123996
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000024
NCBI id null
chromosome length 8644187
location 4662375 ~ 4662574 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU140795
GAACTCGACTTTGTATTTCATTTAACAACAATCCCTAATAATAAAGACAGTAGCCTGCATGTTTAACTATAATGTGAATGCTTGTTATATAATGTAATCAGTGCAGGCTAATCCTTGAGGTTCTTTGTCAAGATGAATAAGTGTGGAAAATAAATGCATGACAGGAGTGACAGAATTAAGTTCATTATCTCATTTTCAAC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU140795 True 200 lncRNA 0.32 1 4662375 4662574

Neighbor


gene id symbol gene type direction distance location
CI01000024_04596928_04606949 NA coding downstream 55426 4596755 ~ 4606949 (-)
CI01000024_04584906_04590559 NA coding downstream 71654 4584454 ~ 4590721 (-)
CI01000024_04565630_04567525 KLF2 coding downstream 94741 4565222 ~ 4567634 (-)
CI01000024_04555804_04556790 NA coding downstream 105227 4555514 ~ 4557148 (-)
CI01000024_04542156_04543940 NFIL3-5 coding downstream 118404 4540433 ~ 4543971 (-)
CI01000024_04775678_04783105 NA coding upstream 112409 4774983 ~ 4783105 (-)
CI01000024_04849096_04855992 NA coding upstream 186251 4848825 ~ 4856309 (-)
CI01000024_04860251_04882047 ERBB3A coding upstream 197528 4860102 ~ 4882804 (-)
CI01000024_04890922_04892119 NA coding upstream 228202 4890776 ~ 4892154 (-)
CI01000024_04900693_04903891 ARF2B, ARF3A, ARF1L, ARF3, ARF2, ARF1, ARF3.S, ARF5, ARF2A, ARF5.L coding upstream 237276 4899850 ~ 4903966 (-)
G123788 NA non-coding downstream 82758 4578636 ~ 4579617 (-)
G123770 NA non-coding downstream 83852 4578194 ~ 4578523 (-)
G123946 NA non-coding downstream 86415 4511076 ~ 4575960 (-)
G123940 NA non-coding downstream 161197 4500654 ~ 4501178 (-)
G123937 NA non-coding downstream 213271 4447190 ~ 4449104 (-)
G123998 NA non-coding upstream 1604 4664178 ~ 4664387 (-)
G123999 NA non-coding upstream 1967 4664541 ~ 4665029 (-)
G124000 NA non-coding upstream 2635 4665209 ~ 4665540 (-)
G123785 NA non-coding upstream 49287 4711861 ~ 4712517 (-)
G123783 NA non-coding upstream 53290 4715864 ~ 4717029 (-)
CI01000024_03938368_03941795 NA other downstream 720451 3938315 ~ 3941924 (-)
G123233 NA other downstream 2107339 2547460 ~ 2555036 (-)
CI01000024_00825386_00837898 NA other downstream 3835524 824968 ~ 838550 (-)
G125457 NA other upstream 2694663 7357237 ~ 7358104 (-)
G125798 NA other upstream 3313093 7975667 ~ 7976047 (-)

Expression



Co-expression Network