G129642


Basic Information

Item Value
gene id G129642
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 4261781 ~ 4266880 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU147320
CAGGACCCTTAGACGAGGAGTTTTTAAGCAAGTCATATTCTCTTGCTGGGCTCGTGCTCGTCTTCTGCTGGGTCGTCCTGTCTCCTGCTTTCTCGGTGGTCTCTCCAGCCTGTGTGTCTGTTGTAGTGTGTGCAGATACAGAGAGAGCCACCAAACAGTTTCCTCAAACTGTCACCAGTTACTTTGACTGTTATTTTTGGTGTCTCAGGTTTCACCCTGAATAAACTTGTTCTTTTGTTCACCGCAACTTGAGTCCTCCTTTCATTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU147320 True 267 lncRNA 0.47 2 4261781 4266880

Neighbor

gene id symbol gene type direction distance location
CI01000026_04154066_04159758 NA coding downstream 102023 4154052 ~ 4159758 (-)
CI01000026_04126777_04133370 NA coding downstream 127110 4125104 ~ 4134671 (-)
CI01000026_04083042_04094349 NA coding downstream 166714 4082797 ~ 4095067 (-)
CI01000026_04067135_04076151 SLC7A6 coding downstream 185630 4066989 ~ 4076151 (-)
CI01000026_04038343_04060958 SCUBE2 coding downstream 200823 4037500 ~ 4060958 (-)
CI01000026_04341911_04342442 NRN1LB coding upstream 74797 4341677 ~ 4342442 (-)
CI01000026_04359229_04359987 THAP11 coding upstream 91878 4358157 ~ 4360456 (-)
CI01000026_04396015_04397830 FBXL8 coding upstream 129025 4395905 ~ 4397921 (-)
CI01000026_04416862_04417674 EXOSC6 coding upstream 149927 4416807 ~ 4417984 (-)
CI01000026_04430286_04481358 HERC1 coding upstream 162932 4429812 ~ 4482544 (-)
CI01000026_04255428_04291509 NA non-coding downstream 6441 4255111 ~ 4293947 (-)
G129638 NA non-coding downstream 10603 4250917 ~ 4251178 (-)
G129603 NA non-coding downstream 66313 4194169 ~ 4195468 (-)
G129581 NA non-coding downstream 139086 4122396 ~ 4122695 (-)
G129579 NA non-coding downstream 142291 4119148 ~ 4119490 (-)
G129657 NA non-coding upstream 120183 4387063 ~ 4425882 (-)
G129724 NA non-coding upstream 233595 4500475 ~ 4501716 (-)
G129735 NA non-coding upstream 283320 4550200 ~ 4550437 (-)
G129739 NA non-coding upstream 289673 4556553 ~ 4557005 (-)
G129476 NA other downstream 590897 3670574 ~ 3670884 (-)
CI01000026_03439507_03490314 PDE3B other downstream 771278 3438795 ~ 3490503 (-)
G127418 NA other downstream 2525675 1735777 ~ 1736220 (-)
CI01000026_00986386_01002180 NA other downstream 3259192 986182 ~ 1002180 (-)
G129658 NA other upstream 100416 4367296 ~ 4373069 (-)
G129750 NA other upstream 546170 4785885 ~ 4820249 (-)
G130256 NA other upstream 2008631 6275511 ~ 6317154 (-)
G131742 NA other upstream 4039896 8306776 ~ 8307707 (-)
G132575 NA other upstream 5120271 9387151 ~ 9387716 (-)

Expression


Co-expression Network