G140408



Basic Information


Item Value
gene id G140408
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 4210199 ~ 4210431 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU159591
CATAAGACAAGTCATTTCACTCGGCGGCCATCTTTGAAACGTCTCTCGGGCATGCAAGTGCAGCTCCTATCTCTTTGAATGGGGAAACATGAAATTCTCCAAAGCTGTTTGCCAAGCTTTCGATTAAATTTCATATTTGAAATCACCAATGAAATCTGACAACAACTGTCTTGTTTTTTTTATTTTTTTATTTTGTTTCTAAACGCTCGAATCGTGACAAAAAACGATATTTA

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU159591 True 233 lncRNA 0.36 1 4210199 4210431

Neighbor


gene id symbol gene type direction distance location
CI01000027_04054186_04103227 NA coding upstream 105779 4053038 ~ 4104420 (+)
CI01000027_04015806_04037491 NA coding upstream 171425 4015730 ~ 4038774 (+)
CI01000027_04012798_04014351 NA coding upstream 195848 4012747 ~ 4014351 (+)
CI01000027_03998691_04000730 RPP25L coding upstream 209365 3998168 ~ 4000834 (+)
CI01000027_03976548_03994948 NA coding upstream 215171 3975433 ~ 3995028 (+)
CI01000027_04213570_04229519 PTPN23, PTPN23A coding downstream 2067 4212498 ~ 4229677 (+)
CI01000027_04350540_04357555 SHE coding downstream 139583 4350014 ~ 4358099 (+)
CI01000027_04381523_04393547 CHRNB2B coding downstream 171092 4381523 ~ 4394114 (+)
CI01000027_04470309_04483532 NA coding downstream 259714 4470145 ~ 4483559 (+)
CI01000027_04485614_04488056 NA coding downstream 273460 4483891 ~ 4488056 (+)
G140394 NA non-coding upstream 34854 4174904 ~ 4175345 (+)
G140392 NA non-coding upstream 35538 4170063 ~ 4174661 (+)
G140391 NA non-coding upstream 41564 4168409 ~ 4168635 (+)
G140386 NA non-coding upstream 63405 4146488 ~ 4146794 (+)
G140384 NA non-coding upstream 69771 4139939 ~ 4140428 (+)
G140482 NA non-coding downstream 110959 4321390 ~ 4321592 (+)
G140489 NA non-coding downstream 151618 4362049 ~ 4362257 (+)
G140490 NA non-coding downstream 191058 4401489 ~ 4403088 (+)
G140447 NA non-coding downstream 193895 4404326 ~ 4413069 (+)
G140495 NA non-coding downstream 203923 4414354 ~ 4414576 (+)
G138953 NA other upstream 690134 3502072 ~ 3520065 (+)
G138915 NA other upstream 723552 3484387 ~ 3486647 (+)
G138515 NA other upstream 2533339 1664408 ~ 1676860 (+)
G138436 NA other upstream 2702383 1506961 ~ 1507816 (+)
G138290 NA other upstream 3211018 995970 ~ 999181 (+)
G140436 NA other downstream 526967 4737398 ~ 4774262 (+)
G140440 NA other downstream 569986 4780417 ~ 4785660 (+)
CI01000027_05050310_05055447 NA other downstream 838492 5050310 ~ 5055755 (+)
CI01000027_05069310_05070638 NA other downstream 858921 5067917 ~ 5070868 (+)
CI01000027_05071693_05072917 NA other downstream 861631 5071693 ~ 5073136 (+)

Expression



Co-expression Network