G144029


Basic Information

Item Value
gene id G144029
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 10192458 ~ 10192661 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU163640
CAATTTTCATCATTTAGGCCTAATTTGTAATCAGTAACAGACTACAATTTGCAAGTAATCTGCCCATCACTGAGTACAGATGTATAAAATTAAGATCAAATATACATATAAATTACATATAAACAAATGTCTCAAATGTGTAATCAAGAACAAGAAGCCTAGTATCCTGGTAGCCTAGACAGTCAAACCAAAAATTATTCAGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU163640 True 204 lncRNA 0.31 1 10192458 10192661

Neighbor

gene id symbol gene type direction distance location
CI01000027_10098742_10105152 RRAGC.S, RRAGCA, RRAGCB, RRAGC coding upstream 87150 10098712 ~ 10105308 (+)
CI01000027_10090545_10093306 CX55.5 coding upstream 98712 10090545 ~ 10093746 (+)
CI01000027_10072946_10084310 RHBDL2 coding upstream 107892 10072437 ~ 10084566 (+)
CI01000027_10055186_10067131 AKIRIN1 coding upstream 125327 10055186 ~ 10067131 (+)
CI01000027_10048220_10051640 NA coding upstream 140714 10048127 ~ 10051744 (+)
CI01000027_10368925_10370031 POU3F1, POU3F1.L, POU3F1.S coding downstream 175746 10368407 ~ 10371305 (+)
CI01000027_10408345_10410012 NA coding downstream 213435 10406096 ~ 10410362 (+)
CI01000027_10437783_10448105 FHL3, FHL3A, FHL3.S coding downstream 245122 10437783 ~ 10448355 (+)
CI01000027_10526694_10541815 GNL2 coding downstream 334033 10526694 ~ 10542130 (+)
CI01000027_10545286_10547348 NA coding downstream 352625 10545286 ~ 10547894 (+)
G144020 NA non-coding upstream 10921 10181333 ~ 10181537 (+)
G143258 NA non-coding upstream 42094 10150117 ~ 10150364 (+)
G143252 NA non-coding upstream 59788 10132471 ~ 10132670 (+)
G143246 NA non-coding upstream 77447 10114774 ~ 10115011 (+)
G143244 NA non-coding upstream 78298 10113954 ~ 10114160 (+)
G144121 NA non-coding downstream 186171 10378832 ~ 10379050 (+)
G144125 NA non-coding downstream 196221 10388882 ~ 10389100 (+)
G144063 NA non-coding downstream 210021 10402682 ~ 10403359 (+)
G144251 NA non-coding downstream 266664 10459325 ~ 10459566 (+)
G144265 NA non-coding downstream 294479 10487140 ~ 10487341 (+)
G143033 NA other upstream 462907 9728815 ~ 9729551 (+)
CI01000027_08255251_08264629 NA other upstream 1931632 8255073 ~ 8264897 (+)
CI01000027_08026500_08029412 ENSAB, ENSA other upstream 2160417 8025788 ~ 8032041 (+)
CI01000027_07947743_07951397 NA other upstream 2240516 7947657 ~ 7951942 (+)
CI01000027_07469157_07471720 NA other upstream 2720744 7468964 ~ 7471999 (+)

Expression


Co-expression Network