G145237


Basic Information

Item Value
gene id G145237
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000028
NCBI id null
chromosome length 9874160
location 1099121 ~ 1099438 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU165026
GTGGGGCTGGGTTTTATACACTGGGAATAGACTGGATGGTGTAAAGTAGGTGTTGCATACCTGGTAGAATTTTGTTTTGAATATCGAAACGCCGCTAAATGACACCTCTGACAAAAATGAGATAATGATATTAAGCGAATGCTCTCTGCACATAGTATACGTTCATCAAATGACAGGATTTTGCGGGTAGCAAGTAAACACAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU165026 True 204 lncRNA 0.40 2 1099121 1099438

Neighbor

gene id symbol gene type direction distance location
CI01000028_01011845_01028684 NA coding downstream 69516 1011608 ~ 1029605 (-)
CI01000028_00801939_00810126 SMTLA coding downstream 288995 801323 ~ 810126 (-)
CI01000028_00767836_00797742 NA coding downstream 299736 767679 ~ 799385 (-)
CI01000028_00704858_00705817 NA coding downstream 392354 704770 ~ 706767 (-)
CI01000028_00616942_00640490 FLI1, FLI1A coding downstream 456945 616390 ~ 642176 (-)
CI01000028_01381059_01398155 BARX2 coding upstream 279734 1379172 ~ 1398357 (-)
CI01000028_01403859_01408636 NA coding upstream 304268 1403706 ~ 1408680 (-)
CI01000028_01582515_01591864 NA coding upstream 482591 1582029 ~ 1592168 (-)
CI01000028_01707320_01709779 NA coding upstream 607320 1706758 ~ 1710606 (-)
CI01000028_01770721_01773265 NA coding upstream 671203 1769608 ~ 1773344 (-)
G145155 NA non-coding downstream 41802 972946 ~ 1057319 (-)
G145152 NA non-coding downstream 136590 962116 ~ 962531 (-)
G145141 NA non-coding downstream 164382 934476 ~ 934739 (-)
G145113 NA non-coding downstream 251629 847245 ~ 847492 (-)
G145108 NA non-coding downstream 261553 837352 ~ 837568 (-)
G145279 NA non-coding upstream 112397 1211835 ~ 1212278 (-)
G145282 NA non-coding upstream 127041 1226479 ~ 1238778 (-)
G145293 NA non-coding upstream 147846 1247284 ~ 1255993 (-)
G145296 NA non-coding upstream 159180 1258618 ~ 1258842 (-)
G145297 NA non-coding upstream 159765 1259203 ~ 1259465 (-)
CI01000028_00474810_00475211 NA other downstream 623775 473609 ~ 475211 (-)
G144855 NA other downstream 963245 135392 ~ 137202 (-)
G146190 NA other upstream 998132 2097570 ~ 2111265 (-)
G146238 NA other upstream 1047940 2147378 ~ 2160038 (-)
CI01000028_02441408_02445596 RPL35A, GM10247 other upstream 1341894 2441332 ~ 2445596 (-)
G149329 NA other upstream 5600075 6699513 ~ 6701240 (-)
CI01000028_06969947_06983352 NA other upstream 5871319 6965064 ~ 6984084 (-)

Expression


Co-expression Network