G161088


Basic Information

Item Value
gene id G161088
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 6004543 ~ 6005636 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU182877
GAGCAGTTGGCTCATCTTGCCAGCTTTAGATACTGTGTGGGTTACAATTTCGCCATCGTCTGGAATCCAGGGACCACAAATCCCTCCGCCTCTCATGAGCGCAAGAGGACAGGAGTGAATGTTAGCATGATACACGCAGCAGTTGTCTTCATTGGCGTTGTTCCAGTTCGAGGGACATTCATGCTCAAGGCAGAATCTTTTGGCCTCTGAAGCATTACTGAACTGGAAAATCTTGTTTTTAACCGCATATTCATAAAAGGAATCTGTGGCAGTGACAGAATAGGTAACGTTGAACTCCTCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU182877 True 301 lncRNA 0.47 3 6004543 6005636

Neighbor

gene id symbol gene type direction distance location
CI01000030_05996557_05996952 NA coding downstream 7001 5996026 ~ 5997542 (-)
CI01000030_05801355_05807277 NA coding downstream 197266 5801321 ~ 5807277 (-)
CI01000030_05791222_05793350 NA coding downstream 211193 5791053 ~ 5793350 (-)
CI01000030_05784109_05788689 NA coding downstream 215854 5783816 ~ 5788689 (-)
CI01000030_05561747_05564633 NA coding downstream 439833 5561747 ~ 5564710 (-)
CI01000030_06042392_06063112 VTG1, VTG7, VTG6, VTG4 coding upstream 36618 6042254 ~ 6063126 (-)
CI01000030_06070218_06078371 VTG1 coding upstream 64506 6070142 ~ 6078378 (-)
CI01000030_06079733_06090776 NA coding upstream 74055 6079691 ~ 6090776 (-)
CI01000030_06092897_06102203 NA coding upstream 87204 6092840 ~ 6102631 (-)
CI01000030_06107092_06109831 NA coding upstream 101017 6106653 ~ 6110976 (-)
G161083 NA non-coding downstream 25755 5975558 ~ 5978788 (-)
G161050 NA non-coding downstream 40393 5963170 ~ 5964150 (-)
G161052 NA non-coding downstream 43407 5957988 ~ 5961136 (-)
G161056 NA non-coding downstream 47614 5956443 ~ 5956929 (-)
G161072 NA non-coding downstream 53764 5950561 ~ 5950779 (-)
G161089 NA non-coding upstream 909 6006545 ~ 6006901 (-)
G161093 NA non-coding upstream 11865 6017501 ~ 6018311 (-)
G161094 NA non-coding upstream 12810 6018446 ~ 6018768 (-)
G161095 NA non-coding upstream 13682 6019318 ~ 6019832 (-)
G161096 NA non-coding upstream 14643 6020279 ~ 6020758 (-)
G160949 NA other downstream 204117 5797297 ~ 5800426 (-)
G160712 NA other downstream 492469 5456960 ~ 5512074 (-)
G160713 NA other downstream 581030 5419119 ~ 5423513 (-)
CI01000030_03491770_03493119 CELF5A other downstream 2511443 3490119 ~ 3493741 (-)
CI01000030_06131710_06138371 NA other upstream 127739 6131090 ~ 6138406 (-)
CI01000030_06701334_06704398 MGC53794, FAM195A, FAM195A.S, MCRIP2 other upstream 695419 6701055 ~ 6704745 (-)
CI01000030_06747047_06752255 NA other upstream 737622 6746960 ~ 6752411 (-)
G163065 NA other upstream 918847 6924483 ~ 6925657 (-)
G163139 NA other upstream 1143838 7149474 ~ 7150144 (-)

Expression


Co-expression Network