G164008



Basic Information


Item Value
gene id G164008
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 9284872 ~ 9285082 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU186315
CTCTCGCAGTACTTTTATGTCATACGCCAATCGGTCTGCGCAGCCCCGATGCATCTCGAACAAGCCTAATGACATGCAATAGATGTTTTTCAAAATACTAACCGTTATTTCACGAGTTCACACATACAAATAATCAGATAAAGTAACATGCGTATTTGGCGTGCTGTCCAAAGAGAGGGCTCAGAGCTTAGTATTTTGGGTTATGGGCGGC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU186315 True 211 lncRNA 0.44 1 9284872 9285082

Neighbor


gene id symbol gene type direction distance location
CI01000030_09253701_09256358 NA coding downstream 27082 9252115 ~ 9257790 (-)
CI01000030_09225959_09236989 NA coding downstream 45590 9225332 ~ 9239282 (-)
CI01000030_09176691_09178066 NA coding downstream 106806 9176645 ~ 9178066 (-)
CI01000030_09038299_09059689 NA coding downstream 224852 9038248 ~ 9060020 (-)
CI01000030_08934545_08939716 NA coding downstream 345153 8934141 ~ 8939719 (-)
CI01000030_09382055_09418356 NA coding upstream 96902 9381984 ~ 9419047 (-)
CI01000030_09433282_09440636 NA coding upstream 147834 9432916 ~ 9441088 (-)
CI01000030_09448873_09453673 NA coding upstream 163690 9448772 ~ 9454092 (-)
CI01000030_09500443_09502785 NA coding upstream 215181 9500263 ~ 9502862 (-)
CI01000030_09561245_09573575 NA coding upstream 276080 9561162 ~ 9574107 (-)
G164007 NA non-coding downstream 351 9284321 ~ 9284521 (-)
G164006 NA non-coding downstream 1254 9283288 ~ 9283618 (-)
G164005 NA non-coding downstream 1750 9282877 ~ 9283122 (-)
G164000 NA non-coding downstream 14665 9261853 ~ 9270207 (-)
G164014 NA non-coding upstream 22737 9307819 ~ 9308194 (-)
G163786 NA non-coding upstream 40393 9325475 ~ 9325969 (-)
G164018 NA non-coding upstream 41614 9326696 ~ 9327062 (-)
G164020 NA non-coding upstream 43472 9328554 ~ 9328880 (-)
G163765 NA non-coding upstream 48272 9333354 ~ 9333908 (-)
G163873 NA other downstream 350890 8933413 ~ 8933982 (-)
CI01000030_08185866_08194632 NA other downstream 1092386 8184897 ~ 8197266 (-)
CI01000030_07788973_07791700 TUSC2B, TUSC2 other downstream 1492490 7788797 ~ 7792198 (-)
CI01000030_07736031_07737720 LSM7.L, GM13182, LSM7 other downstream 1546868 7735436 ~ 7737720 (-)
G163139 NA other downstream 2134728 7149474 ~ 7150144 (-)
CI01000030_09277337_09294501 NA other upstream 2124 9276431 ~ 9294802 (-)
G164071 NA other upstream 190106 9475188 ~ 9476264 (-)
CI01000030_10103451_10131419 NA other upstream 830433 10102944 ~ 10133765 (-)

Expression



Co-expression Network