G162827


Basic Information

Item Value
gene id G162827
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 10882356 ~ 10882581 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU184933
GCGGATGTAGATTATTTCTCAATTATAGCCTTGTCCTCTAAACACTGGAAAACACAGAAAAAGTGTTAGATGTTTAGGAAAGCACTTCTCTGCTTTGTTAACAGCCTGACCTTTGTGAGACTTTTAAACTAGACATTAATCTAGAGTTGCCTTATATATCTATAAGAGAACAATTTGTTCTATTTGTACACGGGCGTCAATCTGGCAACCAGGCTCTTTTTCATCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU184933 True 226 lncRNA 0.37 1 10882356 10882581

Neighbor

gene id symbol gene type direction distance location
CI01000030_10860938_10862107 S1PR4 coding upstream 20064 10860768 ~ 10862292 (+)
CI01000030_10775818_10796010 NA coding upstream 85703 10773601 ~ 10796653 (+)
CI01000030_10766284_10769462 NA coding upstream 112872 10766284 ~ 10769484 (+)
CI01000030_10753303_10762765 NA coding upstream 119591 10753303 ~ 10762765 (+)
CI01000030_10738658_10751094 NA coding upstream 130808 10738087 ~ 10751548 (+)
CI01000030_10911224_10918511 NA coding downstream 25785 10908366 ~ 10918929 (+)
CI01000030_10936461_10939911 NA coding downstream 53880 10936461 ~ 10940790 (+)
CI01000030_10958494_10960930 TNFAIP8L1 coding downstream 74576 10957157 ~ 10962204 (+)
CI01000030_10968005_10969830 NA coding downstream 84525 10967106 ~ 10970051 (+)
CI01000030_10993343_11015527 ZFR2 coding downstream 110762 10993343 ~ 11015855 (+)
G162822 NA non-coding upstream 11176 10870534 ~ 10871180 (+)
G162819 NA non-coding upstream 25264 10856858 ~ 10857092 (+)
G162818 NA non-coding upstream 25888 10856049 ~ 10856468 (+)
G162817 NA non-coding upstream 27371 10854483 ~ 10854985 (+)
G162813 NA non-coding upstream 31379 10850644 ~ 10850977 (+)
G162830 NA non-coding downstream 14259 10896840 ~ 10898448 (+)
G162855 NA non-coding downstream 92180 10974761 ~ 10975108 (+)
G162859 NA non-coding downstream 98917 10981498 ~ 10982379 (+)
G162762 NA non-coding downstream 170692 11053273 ~ 11091871 (+)
G162821 NA other upstream 13916 10866012 ~ 10868440 (+)
CI01000030_10473378_10509560 NA other upstream 380713 10471835 ~ 10511071 (+)
G162297 NA other upstream 661132 10133299 ~ 10221224 (+)
CI01000030_10039688_10047019 NA other upstream 836473 10039358 ~ 10047210 (+)
CI01000030_11362386_11380216 CALR3A, CALR3, CALR3B other downstream 458174 11362114 ~ 11380772 (+)
G162951 NA other downstream 610020 11492601 ~ 11496119 (+)

Expression


Co-expression Network