G162875


Basic Information

Item Value
gene id G162875
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 11103337 ~ 11103651 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU184988
GTTATGACGTAACGAAGCCACGTTTACTGAAATCACGTGATTTTGGCAGTTTAAAACACGCTCCGAACCACTGATTCGAAACAAAAGATTCGTAAAGGTTTCATGAAGCAGTGTTTCGAAAGCGCCCATCACTACCAACATCACAAGCCAAAATCTCAAAATTTTCACCCTGGCCAGAAATTTCTAAAAAGTTCGGTTTCAGTAGCCTGACACTGCATTTGTGTGTGGACGAACCGCCAAACCGCATAGAAAAAGCTGCAGTTTTGAAAATAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU184988 True 273 lncRNA 0.42 2 11103337 11103651

Neighbor

gene id symbol gene type direction distance location
CI01000030_11074061_11090319 NA coding upstream 12861 11073685 ~ 11090476 (+)
CI01000030_11067119_11069478 NA coding upstream 33812 11067034 ~ 11069525 (+)
CI01000030_11047852_11057798 CHERP coding upstream 45539 11047762 ~ 11057798 (+)
CI01000030_11035570_11040272 RX1, RAX2 coding upstream 62104 11035257 ~ 11041233 (+)
CI01000030_11017331_11024754 MATK coding upstream 78235 11017331 ~ 11025102 (+)
CI01000030_11114957_11124683 NA coding downstream 11217 11114868 ~ 11125104 (+)
CI01000030_11168935_11171909 NA coding downstream 64759 11168410 ~ 11172305 (+)
CI01000030_11184734_11195838 NA coding downstream 79055 11182706 ~ 11195865 (+)
CI01000030_11211094_11214554 NA coding downstream 105657 11209308 ~ 11214698 (+)
CI01000030_11278476_11281567 NA coding downstream 174745 11278396 ~ 11281743 (+)
G162762 NA non-coding upstream 11466 11053273 ~ 11091871 (+)
G162859 NA non-coding upstream 120958 10981498 ~ 10982379 (+)
G162855 NA non-coding upstream 128229 10974761 ~ 10975108 (+)
CI01000030_10911224_10918511 NA non-coding upstream 192774 10908366 ~ 10918929 (+)
G162830 NA non-coding upstream 204889 10896840 ~ 10898448 (+)
G162892 NA non-coding downstream 112336 11215987 ~ 11234587 (+)
G162891 NA non-coding downstream 122009 11225660 ~ 11252096 (+)
G162893 NA non-coding downstream 131072 11234723 ~ 11236919 (+)
G162895 NA non-coding downstream 143017 11246668 ~ 11253729 (+)
G162912 NA non-coding downstream 156497 11260148 ~ 11292095 (+)
G162821 NA other upstream 234897 10866012 ~ 10868440 (+)
CI01000030_10738658_10751094 NA other upstream 362786 10738087 ~ 10751548 (+)
CI01000030_10473378_10509560 NA other upstream 601694 10471835 ~ 10511071 (+)
G162297 NA other upstream 882113 10133299 ~ 10221224 (+)
CI01000030_10039688_10047019 NA other upstream 1057454 10039358 ~ 10047210 (+)
CI01000030_11362386_11380216 CALR3A, CALR3, CALR3B other downstream 237104 11362114 ~ 11380772 (+)
G162951 NA other downstream 388950 11492601 ~ 11496119 (+)

Expression


Co-expression Network