G184987


Basic Information

Item Value
gene id G184987
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000040
NCBI id null
chromosome length 6879596
location 2541171 ~ 2541411 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU210080
AGATAATGATAACGAGAAACAAACAAGACAGAATAACAGAGATGGAAGTTCTCGCACGAGTTTCACATGAATCTCCCGCGAGAACGTCATGAAAGCTTCACGTTGCTCATTACAATATGTTTCGTCGAACGCAAAGTCGACTCTCATGCAGGCGCTGGTGACAGTTGGTCGGAAGCGAAAAGATGAATAGCCTAAACCATGAGAAAATTTCTGGGTGTTCTTTATTTTCTTTTAATACAGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU210080 True 241 lncRNA 0.41 1 2541171 2541411

Neighbor

gene id symbol gene type direction distance location
CI01000040_02475489_02482435 NA coding upstream 58656 2475489 ~ 2482515 (+)
CI01000040_02444252_02460962 NA coding upstream 80209 2443561 ~ 2460962 (+)
CI01000040_02315449_02344137 GABRQ, GABRB4 coding upstream 196858 2315449 ~ 2344313 (+)
CI01000040_01882704_01887004 BRCC3 coding upstream 654036 1881793 ~ 1887135 (+)
CI01000040_01876498_01878546 FUNDC2 coding upstream 661863 1876498 ~ 1879308 (+)
CI01000040_02558495_02563310 NA coding downstream 16972 2558383 ~ 2563546 (+)
CI01000040_02602517_02603172 NA coding downstream 60946 2602357 ~ 2603623 (+)
CI01000040_02609749_02611069 ARHGAP26 coding downstream 68338 2609749 ~ 2611235 (+)
CI01000040_02650575_02692600 NA coding downstream 108132 2649543 ~ 2692671 (+)
CI01000040_02889343_02891410 KCTD16B, KCTD16 coding downstream 347932 2889343 ~ 2891439 (+)
G184982 NA non-coding upstream 98951 2441978 ~ 2442220 (+)
G184981 NA non-coding upstream 99339 2441611 ~ 2441832 (+)
G184979 NA non-coding upstream 101170 2439791 ~ 2440001 (+)
G184976 NA non-coding upstream 106185 2434784 ~ 2434986 (+)
G184418 NA non-coding upstream 171525 2369395 ~ 2369646 (+)
G184989 NA non-coding downstream 1394 2542805 ~ 2543132 (+)
G185028 NA non-coding downstream 57110 2598521 ~ 2598937 (+)
G185029 NA non-coding downstream 59019 2600430 ~ 2600652 (+)
G185084 NA non-coding downstream 262852 2804263 ~ 2804512 (+)
G184003 NA other upstream 1304682 1230292 ~ 1236489 (+)
CI01000040_00977184_00977458 NDUA2, NDUFA2 other upstream 1563008 977184 ~ 978163 (+)
CI01000040_00240852_00305487 GABRB2 other upstream 2264316 240849 ~ 313275 (+)
G183420 NA other upstream 2376249 157543 ~ 164922 (+)
G183366 NA other upstream 2480774 53691 ~ 60397 (+)
G185296 NA other downstream 792167 3333578 ~ 3333983 (+)
G185884 NA other downstream 1197576 3738987 ~ 3739281 (+)
G185947 NA other downstream 1432354 3973765 ~ 3974123 (+)
G187510 NA other downstream 3427634 5969045 ~ 5971732 (+)
G188149 NA other downstream 4267280 6808691 ~ 6809130 (+)

Expression


Co-expression Network