CI01000050_03672005_03672822 (NKX3-1)


Basic Information

Item Value
gene id CI01000050_03672005_03672822
gene name NKX3-1
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000050
NCBI id null
chromosome length 7556436
location 3671906 ~ 3672888 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000050_03672005_03672822.mRNA
AGTGCCAATTACTTACCAGGAGGAAGACGCTTTATCCTTGACTTTATCAGGAATTTGGCGACACAGATGGCGGATTCAAACAAGCAGTTGACGTCGTTTTTCATAGAGGACATTTTATCCTTAAAAGAGGATAAAAAAGATGACTTCTGCAATTCTGAGAGCGACAGAACCGACAAAAGAACAGATATCTCTGTTTGTCTGGATTCTGAGGATAAAACAATGTCGTCGACAGAGATGACAGGCGGCGGCGTGAAAAAGAAGCGATCGCGCGCCGCATTCACGCACCTGCAGGTGCTGGAGCTCGAGAAGAAGTTCAGCCGTCAGCGATACCTGAGCGCGCCCGAGCGCGCGCACCTCGCGAGCGCACTGCACCTCACGGAGACTCAGGTGAAAATCTGGTTCCAGAACAGGAGATATAAAACCAAACGGAGGCAGTTAACGACTGAGCACGCCAAGGAATACTTTCAGAAATCGGACGCGAGCGCTATGGCTGCTACAGAGGAGGACTTTTTCAGAGCGTCACTTTTAGCGACAGTCTATAAATCCTTTCCATACCGGCCTTACGTGTATGACTTGCACGGACTGAGAGTATGGAGACCAGCACTGTGATCACAGGGATATTAACCTGGACTTTGGGAATTTTCTCAGATTATTGTGAATATTATGGTGTTTTTTAATCTTGTACAGCTTTGCATTCTGTGTAATAAA

Function

symbol description
nkx3-1 Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in cell differentiation and regulation of transcription by RNA polymerase II. Predicted to act upstream of or within regulation of transcription, DNA-templated. Predicted to be active in nucleus. Is expressed in sclerotome. Human ortholog(s) of this gene implicated in hepatocellular carcinoma. Orthologous to human NKX3-1 (NK3 homeobox 1).

GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process

KEGG:

id description
K09348 NKX3-1; homeobox protein Nkx-3.1

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000050_03672005_03672822.mRNA True 708 mRNA 0.47 2 3671906 3672888

Neighbor

gene id symbol gene type direction distance location
CI01000050_03635030_03637939 NA coding downstream 32746 3634573 ~ 3639160 (-)
CI01000050_03491159_03514757 NA coding downstream 157149 3491088 ~ 3514757 (-)
CI01000050_03362364_03363241 NA coding downstream 307649 3362284 ~ 3364257 (-)
CI01000050_03142876_03156191 KLHL22 coding downstream 513342 3142811 ~ 3158564 (-)
CI01000050_02945824_02971282 GNA14, GNA14A coding downstream 700537 2944921 ~ 2971369 (-)
CI01000050_03721951_03724091 NKX2.7 coding upstream 48909 3721797 ~ 3724452 (-)
CI01000050_03759473_03767344 STC1 coding upstream 86537 3759425 ~ 3767563 (-)
CI01000050_03776675_03777031 NA coding upstream 103696 3776584 ~ 3777215 (-)
CI01000050_03798634_03799395 NA coding upstream 125727 3798615 ~ 3799395 (-)
CI01000050_03916668_03927175 NA coding upstream 241482 3914370 ~ 3927175 (-)
G214473 NA non-coding downstream 16738 3654920 ~ 3655168 (-)
G214432 NA non-coding downstream 59826 3599224 ~ 3612080 (-)
G214435 NA non-coding downstream 62681 3603565 ~ 3609225 (-)
G214448 NA non-coding downstream 81652 3590027 ~ 3590254 (-)
G214434 NA non-coding downstream 91253 3577870 ~ 3580653 (-)
G214487 NA non-coding upstream 37213 3710101 ~ 3710420 (-)
G214521 NA non-coding upstream 44782 3717670 ~ 3717965 (-)
G214524 NA non-coding upstream 55709 3728597 ~ 3728812 (-)
G214529 NA non-coding upstream 78429 3751317 ~ 3751524 (-)
G214530 NA non-coding upstream 80159 3753047 ~ 3753268 (-)
G214436 NA other downstream 82849 3525816 ~ 3589057 (-)
G214314 NA other downstream 247649 3413448 ~ 3424257 (-)
G214027 NA other downstream 1099004 2557166 ~ 2572902 (-)
G214017 NA other downstream 1207208 2462176 ~ 2464698 (-)
CI01000050_04564233_04580815 KANSL3 other upstream 890799 4563687 ~ 4581278 (-)
G215935 NA other upstream 1376028 5048916 ~ 5073109 (-)
G216093 NA other upstream 1816669 5489557 ~ 5552103 (-)
G216408 NA other upstream 2683129 6356017 ~ 6356511 (-)
G216931 NA other upstream 3491207 7164095 ~ 7165401 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location