RNA id: TCONS_00015674


Basic Information

Item Value
RNA id TCONS_00015674
length 188
RNA type mRNA
GC content 0.44
exon number 2
gene id XLOC_008015
representative True

Chromosome Information

Item Value
chromosome id NC_007125.7
NCBI id CM002898.2
chromosome length 52660232
location 34045284 ~ 34074510 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GAGACAGAATGCTTCAGATATTGGAAAGCATGAAAAATCATTCACTCATATCGGAAAGAGGGGTCATCCTAAAGGAGACGCTGTACAAGAAGTCACAGCAGAAGAGAAGAACATCACCGTGCAATTACAAAGAGAGGACATTCATATTAAACACACAGGACCTGGCTTACTTTGAACAGCGTCCCGGG

Function

GO:

id name namespace
GO:0002250 adaptive immune response biological_process
GO:0035556 intracellular signal transduction biological_process
GO:0038083 peptidyl-tyrosine autophosphorylation biological_process
GO:0006468 protein phosphorylation biological_process
GO:0001865 NK T cell differentiation biological_process
GO:0016310 phosphorylation biological_process
GO:0050852 T cell receptor signaling pathway biological_process
GO:0050853 B cell receptor signaling pathway biological_process
GO:0016740 transferase activity molecular_function
GO:0005524 ATP binding molecular_function
GO:0046872 metal ion binding molecular_function
GO:0000166 nucleotide binding molecular_function
GO:0004672 protein kinase activity molecular_function
GO:0016301 kinase activity molecular_function
GO:0004713 protein tyrosine kinase activity molecular_function
GO:0004715 non-membrane spanning protein tyrosine kinase activity molecular_function

KEGG:

id description
ko04660 T cell receptor signaling pathway
ko04670 Leukocyte transendothelial migration
ko04062 Chemokine signaling pathway
ko01001 Protein kinases

ZFIN:

id description
ZDB-GENE-990415-261 Predicted to enable non-membrane spanning protein tyrosine kinase activity. Predicted to be involved in several processes, including NK T cell differentiation; antigen receptor-mediated signaling pathway; and peptidyl-tyrosine autophosphorylation. Predicted to act upstream of or within immune system process; intracellular signal transduction; and protein phosphorylation. Human ortholog(s) of this gene implicated in lymphoproliferative syndrome 1. Orthologous to human ITK (IL2 inducible T cell kinase).

Ensembl:

ensembl_id ENSDART00000172753

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00015662 lncRNA downstream 160858 33875058 ~ 33898589 (-) True XLOC_008009
TCONS_00015661 lncRNA downstream 187355 33868571 ~ 33872092 (-) True XLOC_008008
TCONS_00016425 lncRNA downstream 281195 33666082 ~ 33778252 (-) True XLOC_008004
TCONS_00016426 lncRNA downstream 314694 33722042 ~ 33744753 (-) True XLOC_008005
TCONS_00016424 lncRNA downstream 591756 33464948 ~ 33467691 (-) True XLOC_007999
TCONS_00016061 lncRNA upstream 269572 34344082 ~ 34490887 (-) False XLOC_008017
TCONS_00016427 lncRNA upstream 388176 34462686 ~ 34489461 (-) True XLOC_008017
TCONS_00015678 lncRNA upstream 437726 34512236 ~ 34512878 (-) True XLOC_008018
TCONS_00016062 lncRNA upstream 455374 34529884 ~ 34532598 (-) False XLOC_008019
TCONS_00015679 lncRNA upstream 455374 34529884 ~ 34535102 (-) True XLOC_008019
TCONS_00015669 mRNA downstream 14995 33982007 ~ 34044452 (-) False XLOC_008014
TCONS_00015670 mRNA downstream 15078 33983349 ~ 34044369 (-) False XLOC_008014
TCONS_00015671 mRNA downstream 15078 33984698 ~ 34044369 (-) False XLOC_008014
TCONS_00015672 mRNA downstream 33131 33984831 ~ 34026316 (-) True XLOC_008014
TCONS_00015668 mRNA downstream 77903 33973921 ~ 33981544 (-) True XLOC_008013
TCONS_00015675 mRNA upstream 51345 34125855 ~ 34276574 (-) True XLOC_008016
TCONS_00015676 mRNA upstream 436190 34510700 ~ 34512859 (-) False XLOC_008018
TCONS_00015677 mRNA upstream 437501 34512011 ~ 34513103 (-) False XLOC_008018
TCONS_00015680 mRNA upstream 487916 34562426 ~ 34633960 (-) False XLOC_008021
TCONS_00015681 mRNA upstream 488343 34562853 ~ 34633960 (-) False XLOC_008021
TCONS_00015641 other downstream 581460 33473804 ~ 33477987 (-) False XLOC_008000
TCONS_00015649 other downstream 581715 33475820 ~ 33477732 (-) False XLOC_008000
TCONS_00015628 other downstream 714474 33340138 ~ 33344973 (-) True XLOC_007991
TCONS_00015626 other downstream 725866 33333448 ~ 33333581 (-) True XLOC_007990
TCONS_00015612 other downstream 827683 33220856 ~ 33231764 (-) True XLOC_007986
TCONS_00015693 other upstream 1318237 35392747 ~ 35405723 (-) True XLOC_008028
TCONS_00015701 other upstream 1497035 35571545 ~ 35853647 (-) True XLOC_008033
TCONS_00015719 other upstream 2355733 36430243 ~ 36437239 (-) True XLOC_008042
TCONS_00015732 other upstream 4689156 38763666 ~ 38774885 (-) False XLOC_008051
TCONS_00015734 other upstream 4696120 38770630 ~ 38782985 (-) True XLOC_008051

Expression Profile

//