RNA id: TCONS_00016943


Basic Information

Item Value
RNA id TCONS_00016943
length 402
RNA type mRNA
GC content 0.46
exon number 5
gene id XLOC_008464
representative False

Chromosome Information

Item Value
chromosome id NC_007126.7
NCBI id CM002899.2
chromosome length 48040578
location 21252532 ~ 21262567 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AGTTAAGTACGTTTCCTCTGGCTGCGGCTACTGTTGTAAACAAGACGCCTCGAGATCAGTAAACGTTCAGATTTTATAAGACAACAAGAAGTGGTAACACAAATTTTACTTGTTACATACTGACAGTGGAGATGAAAGGACAACCGAAAAGTTCTGAACCTGATGTCAGTGTTCCAGTCATTGAAGAAGAAGACCCATCAGCAATCACAACTATTCAATCTGCTTCTACGTTTTCCACGGACCAGCCGATTAAATACCTTTTCAAGACGGAGGGAGCTGGGGGGCAGGTTACATACCGAGTAATCCAGGTTGCAGATGGACAGCTAGAGGCTCAACCTGATGGTACAACAGCTGTTAGTGTAGTGACTGGGTTTCCTGCCACAACACAGCCGGTTACGCAGG

Function

GO:

id name namespace
GO:0046983 protein dimerization activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040426-1072 Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Human ortholog(s) of this gene implicated in cardiovascular system disease and type 2 diabetes mellitus. Orthologous to human USF1 (upstream transcription factor 1).

Ensembl:

ensembl_id ENSDART00000133821

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00018928 lncRNA upstream 1024 21247526 ~ 21251557 (+) False XLOC_008462
TCONS_00018929 lncRNA upstream 1024 21249466 ~ 21251557 (+) True XLOC_008462
TCONS_00018773 lncRNA upstream 6747 21240424 ~ 21245834 (+) True XLOC_008461
TCONS_00018772 lncRNA upstream 88008 21164035 ~ 21164573 (+) True XLOC_008457
TCONS_00018927 lncRNA upstream 214803 21017649 ~ 21037778 (+) True XLOC_008456
TCONS_00016950 lncRNA downstream 14311 21269223 ~ 21272557 (+) True XLOC_008465
TCONS_00018930 lncRNA downstream 68134 21323046 ~ 21427967 (+) False XLOC_008467
TCONS_00018931 lncRNA downstream 68144 21323056 ~ 21495896 (+) False XLOC_008467
TCONS_00018932 lncRNA downstream 68149 21323061 ~ 21390208 (+) False XLOC_008467
TCONS_00018933 lncRNA downstream 68165 21323077 ~ 21390208 (+) False XLOC_008467
TCONS_00016936 mRNA upstream 48110 21202820 ~ 21204471 (+) True XLOC_008460
TCONS_00016930 mRNA upstream 357805 20843161 ~ 20894776 (+) False XLOC_008453
TCONS_00016929 mRNA upstream 443457 20801253 ~ 20809124 (+) True XLOC_008452
TCONS_00016928 mRNA upstream 446386 20799943 ~ 20806195 (+) False XLOC_008452
TCONS_00016924 mRNA upstream 609034 20548212 ~ 20643547 (+) True XLOC_008451
TCONS_00016949 mRNA downstream 8005 21262917 ~ 21275683 (+) False XLOC_008465
TCONS_00016951 mRNA downstream 21823 21276735 ~ 21320638 (+) True XLOC_008466
TCONS_00016956 mRNA downstream 417369 21672281 ~ 21673630 (+) False XLOC_008471
TCONS_00016957 mRNA downstream 417788 21672700 ~ 21673452 (+) True XLOC_008471
TCONS_00016959 mRNA downstream 452988 21707900 ~ 21715436 (+) False XLOC_008472
TCONS_00016937 other upstream 299 21252191 ~ 21252282 (+) True XLOC_008463
TCONS_00016935 other upstream 54295 21180094 ~ 21198286 (+) True XLOC_008459
TCONS_00016934 other upstream 75532 21167142 ~ 21177049 (+) True XLOC_008458
TCONS_00016921 other upstream 717097 20529280 ~ 20535484 (+) False XLOC_008450
TCONS_00016911 other upstream 890609 20355795 ~ 20361972 (+) True XLOC_008446
TCONS_00016953 other downstream 182721 21437633 ~ 21437728 (+) True XLOC_008468
TCONS_00016954 other downstream 182964 21437876 ~ 21437959 (+) True XLOC_008469
TCONS_00016955 other downstream 192744 21447656 ~ 21447800 (+) True XLOC_008467
TCONS_00016960 other downstream 456748 21711660 ~ 21715665 (+) False XLOC_008472
TCONS_00016964 other downstream 512612 21767524 ~ 21770009 (+) True XLOC_008473

Expression Profile

//