RNA id: TCONS_00033238


Basic Information

Item Value
RNA id TCONS_00033238
length 841
lncRNA type inter_gene
GC content 0.32
exon number 4
gene id XLOC_015225
representative False

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 8484394 ~ 8488138 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

aaggttcattgcgatcccaaggttcactgcggttttccacaagatgcagaaacttttgacatatgaattcatcttgactaaggaactcttcacagcactgcagctaaacagtcacaacctcacagagctgcacaactgccccactcagatcagtgttgaagctggaacctcatcttgtgtacagcaaaggcagagctgaaaattcactgtttgtcttgtattgtgtgtggcaaaacctggaataacacatgggagccctccaggaattcctgacactttacgcccaagtctcctcatgctaaccggattgcaatatgacagtctagtcagcataaacacctggactcaccaagcacactttggttctcagtgttttgtaaaaatagtttttgctattcttcagtaaatacttgaatatgttttgaacttattctacttttgatgtttaagttcagaaagttgttattataaacataatttgcatttgtcatgaacttgacttcttgttgttgtgaaagctgtttattatgatggcatttccaaaggcatcatttgaaaagattttttgcagtgcagttttacttgagcttgacataccagatgtatgacatgaataaatatcacaaaataaatataataataataataatacaaaatatacatttccttcaattataattgtttttaatcatttatatatgtatggtaatatattattgcattaaaaacttataaaatatatatttttggttaaaatatatatttttgcatttttgtgtgatttttattatttatttttatttgtggcattataaataaattataaatgtttcattaaaaa

Function

GO:

id name namespace
GO:0016072 rRNA metabolic process biological_process
GO:0022613 ribonucleoprotein complex biogenesis biological_process
GO:0045110 intermediate filament bundle assembly biological_process
GO:0034470 ncRNA processing biological_process
GO:0006364 rRNA processing biological_process
GO:0030490 maturation of SSU-rRNA biological_process
GO:2000026 regulation of multicellular organismal development biological_process
GO:0042254 ribosome biogenesis biological_process
GO:0000469 cleavage involved in rRNA processing biological_process
GO:0042274 ribosomal small subunit biogenesis biological_process
GO:0048340 paraxial mesoderm morphogenesis biological_process
GO:0048341 paraxial mesoderm formation biological_process
GO:0048646 anatomical structure formation involved in morphogenesis biological_process
GO:0003002 regionalization biological_process
GO:0007389 pattern specification process biological_process
GO:0061053 somite development biological_process
GO:0034660 ncRNA metabolic process biological_process
GO:0030684 preribosome cellular_component
GO:0005730 nucleolus cellular_component
GO:0030515 snoRNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00033474 lncRNA upstream 716738 7763907 ~ 7768273 (+) False XLOC_015218
TCONS_00033475 lncRNA upstream 716738 7763911 ~ 7768273 (+) True XLOC_015218
TCONS_00030530 lncRNA upstream 761684 7715806 ~ 7723327 (+) False XLOC_015213
TCONS_00033473 lncRNA upstream 764298 7715792 ~ 7720713 (+) False XLOC_015213
TCONS_00033237 lncRNA upstream 822910 7657408 ~ 7662101 (+) True XLOC_015212
TCONS_00033241 lncRNA downstream 202520 8690658 ~ 8691029 (+) True XLOC_015227
TCONS_00030555 lncRNA downstream 326101 8814239 ~ 8825386 (+) True XLOC_015229
TCONS_00033478 lncRNA downstream 644447 9132585 ~ 9330209 (+) True XLOC_015231
TCONS_00033479 lncRNA downstream 828181 9316319 ~ 9318279 (+) True XLOC_015232
TCONS_00033480 lncRNA downstream 1163578 9651716 ~ 9657047 (+) False XLOC_015236
TCONS_00030546 mRNA upstream 172812 8261109 ~ 8312199 (+) True XLOC_015224
TCONS_00030544 mRNA upstream 370403 8112449 ~ 8114608 (+) True XLOC_015222
TCONS_00030541 mRNA upstream 434513 8031234 ~ 8050498 (+) False XLOC_015221
TCONS_00030542 mRNA upstream 437993 8031381 ~ 8047018 (+) False XLOC_015221
TCONS_00030540 mRNA upstream 610627 7851493 ~ 7874384 (+) True XLOC_015220
TCONS_00030547 mRNA downstream 161155 8649293 ~ 8663104 (+) False XLOC_015226
TCONS_00030548 mRNA downstream 161218 8649356 ~ 8660204 (+) True XLOC_015226
TCONS_00030549 mRNA downstream 229017 8717155 ~ 8777496 (+) False XLOC_015228
TCONS_00030550 mRNA downstream 229027 8717165 ~ 8726072 (+) False XLOC_015228
TCONS_00030551 mRNA downstream 229034 8717172 ~ 8731822 (+) True XLOC_015228
TCONS_00030545 other upstream 295611 8189285 ~ 8189400 (+) True XLOC_015223
TCONS_00030543 other upstream 437754 8045416 ~ 8047257 (+) True XLOC_015221
TCONS_00030536 other upstream 761070 7723870 ~ 7723941 (+) True XLOC_015217
TCONS_00030535 other upstream 761428 7723394 ~ 7723583 (+) True XLOC_015216
TCONS_00030534 other upstream 763621 7721212 ~ 7721390 (+) True XLOC_015215
TCONS_00030568 other downstream 1343200 9831338 ~ 9833806 (+) False XLOC_015238
TCONS_00030569 other downstream 1349894 9838032 ~ 9841864 (+) False XLOC_015238
TCONS_00030571 other downstream 1387391 9875529 ~ 9875645 (+) True XLOC_015239
TCONS_00030577 other downstream 1485743 9973881 ~ 9982953 (+) True XLOC_015242
TCONS_00030590 other downstream 1717863 10206001 ~ 10206118 (+) True XLOC_015249

Expression Profile

//