RNA id: TCONS_00030858


Basic Information

Item Value
RNA id TCONS_00030858
length 351
RNA type mRNA
GC content 0.50
exon number 3
gene id XLOC_015417
representative False

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 23351454 ~ 23361933 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TGCTTATTGCTTGTCGACGTTAACGGCTTAATTAGCACGAAATGGTTTAAATGTCACAATCTCGCCGACATTGATCTCCGAGAAAAGACGTGGTGTATGAAGATGACACAGACGGTCCAGACAAATGGGGTTCAACCCCTCAGCAAGACCTGGGAGCTCAGTCTATATGAATTACAGAGAACTCCACAGGAGGCCATCACGGATGGTCTGGAGATTGCAGTGTCCCCACGCAGCCTGCACAGTGAGCTTATGTGTCCCATCTGCCTGGACATGCTGAAGAACACTATGACCACCAAGGAATGCCTGCACCGTTTCTGTGCCGACTGCATCATCACTGCTCTCAGATCAGGG

Function

GO:

id name namespace
GO:0035518 histone H2A monoubiquitination biological_process
GO:0032330 regulation of chondrocyte differentiation biological_process
GO:0036353 histone H2A-K119 monoubiquitination biological_process
GO:0000122 negative regulation of transcription by RNA polymerase II biological_process
GO:0009948 anterior/posterior axis specification biological_process
GO:0033339 pectoral fin development biological_process
GO:0048701 embryonic cranial skeleton morphogenesis biological_process
GO:0060042 retina morphogenesis in camera-type eye biological_process
GO:1902254 negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator biological_process
GO:0000278 mitotic cell cycle biological_process
GO:0031519 PcG protein complex cellular_component
GO:0071339 MLL1 complex cellular_component
GO:0000151 ubiquitin ligase complex cellular_component
GO:0035102 PRC1 complex cellular_component
GO:0005634 nucleus cellular_component
GO:0016604 nuclear body cellular_component
GO:0005694 chromosome cellular_component
GO:0016740 transferase activity molecular_function
GO:0046872 metal ion binding molecular_function
GO:0003682 chromatin binding molecular_function
GO:0061630 ubiquitin protein ligase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-030131-5243 Predicted to enable chromatin binding activity and ubiquitin protein ligase activity. Acts upstream of or within several processes, including animal organ morphogenesis; negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator; and pectoral fin development. Predicted to be located in nuclear body. Predicted to be part of MLL1 complex and PRC1 complex. Is expressed in brain; eye; gonad; muscle; and pectoral fin. Orthologous to human RNF2 (ring finger protein 2).

Ensembl:

ensembl_id ENSDART00000154645

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00033524 lncRNA upstream 166729 23156012 ~ 23184804 (+) False XLOC_015414
TCONS_00033525 lncRNA upstream 166729 23156014 ~ 23184804 (+) False XLOC_015414
TCONS_00030853 lncRNA upstream 166729 23156047 ~ 23184804 (+) True XLOC_015414
TCONS_00033523 lncRNA upstream 324555 23025321 ~ 23026978 (+) True XLOC_015410
TCONS_00030845 lncRNA upstream 336917 23011833 ~ 23014616 (+) True XLOC_015409
TCONS_00033526 lncRNA downstream 50748 23406453 ~ 23410848 (+) False XLOC_015418
TCONS_00033528 lncRNA downstream 50748 23406453 ~ 23442528 (+) False XLOC_015418
TCONS_00033527 lncRNA downstream 50748 23406453 ~ 23442528 (+) False XLOC_015418
TCONS_00033529 lncRNA downstream 59178 23414883 ~ 23416355 (+) False XLOC_015419
TCONS_00033530 lncRNA downstream 59178 23414883 ~ 23421047 (+) True XLOC_015419
TCONS_00030854 mRNA upstream 58032 23222939 ~ 23293501 (+) False XLOC_015415
TCONS_00030852 mRNA upstream 219399 23130389 ~ 23132134 (+) True XLOC_015413
TCONS_00030851 mRNA upstream 248384 23081402 ~ 23103149 (+) True XLOC_015412
TCONS_00030850 mRNA upstream 251889 23081248 ~ 23099644 (+) False XLOC_015412
TCONS_00030849 mRNA upstream 251890 23081247 ~ 23099643 (+) False XLOC_015412
TCONS_00030860 mRNA downstream 127093 23482798 ~ 23484348 (+) True XLOC_015421
TCONS_00030861 mRNA downstream 257335 23613040 ~ 23620219 (+) False XLOC_015424
TCONS_00030863 mRNA downstream 321474 23677179 ~ 23713760 (+) False XLOC_015425
TCONS_00030865 mRNA downstream 345908 23701613 ~ 23726605 (+) True XLOC_015425
TCONS_00030866 mRNA downstream 375489 23731194 ~ 23745290 (+) True XLOC_015427
TCONS_00030856 other upstream 76752 23274332 ~ 23274781 (+) True XLOC_015415
TCONS_00030855 other upstream 93636 23257777 ~ 23257897 (+) True XLOC_015416
TCONS_00030841 other upstream 360012 22986282 ~ 22991521 (+) True XLOC_015408
TCONS_00030832 other upstream 684833 22660071 ~ 22666700 (+) True XLOC_015401
TCONS_00030805 other upstream 1975939 21375467 ~ 21375594 (+) True XLOC_015384
TCONS_00030864 other downstream 324168 23679873 ~ 23679989 (+) True XLOC_015426
TCONS_00030870 other downstream 657545 24013250 ~ 24014943 (+) True XLOC_015433
TCONS_00030885 other downstream 992884 24348589 ~ 24351040 (+) True XLOC_015440
TCONS_00030891 other downstream 1128584 24484289 ~ 24497841 (+) True XLOC_015443
TCONS_00030897 other downstream 1184342 24540047 ~ 24540765 (+) False XLOC_015445

Expression Profile

//