RNA id: TCONS_00031117



Basic Information


Item Value
RNA id TCONS_00031117
length 414
lncRNA type lincRNA
GC content 0.45
exon number 2
gene id XLOC_015567
representative True

Chromosome Information


Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 32019642 ~ 32127930 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


TGTTTTTTCCTTAACATTTGTTCTAATCTTTTTGATTAGTTCATTTTTCTTGCTTTATTTTTGTAGGCCACGTGGCAACATGTTTTAGAGGCAGTCTGTGATGTAACAGCACTGCTGTCACCTGCATGTCCAGCTGTGCTGGTGGCTCAGAGAAGTGGACTAATGAGGGTCCTAAGCAGTGAATGGACTCGCCACGCTCCACTGCCGGCATTTACACATCTCTCACCATGCGCCTTCCCGTGGAGATTGGCTCACTTCGTTTTCTTCATGATGAATGTCTCTCTGAACCTCTTGTGGCATTTGAGTGAACTGCCGCTATTTTACAGATTCCAGCCCAGACATGATTCATCCAATAGAAACTGCAGAGGAATTTGCTGCATCACAAAACACATACCCTGTTGAGGCTTTCATATG

Function


GO:

id name namespace
GO:0048729 tissue morphogenesis biological_process
GO:0021536 diencephalon development biological_process
GO:0001732 formation of cytoplasmic translation initiation complex biological_process
GO:0022612 gland morphogenesis biological_process
GO:0048513 animal organ development biological_process
GO:0009058 biosynthetic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:0030182 neuron differentiation biological_process
GO:1901576 organic substance biosynthetic process biological_process
GO:0009887 animal organ morphogenesis biological_process
GO:0007275 multicellular organism development biological_process
GO:0009888 tissue development biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0006413 translational initiation biological_process
GO:0060429 epithelium development biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0048562 embryonic organ morphogenesis biological_process
GO:0048850 hypophysis morphogenesis biological_process
GO:0009653 anatomical structure morphogenesis biological_process
GO:0048852 diencephalon morphogenesis biological_process
GO:0048853 forebrain morphogenesis biological_process
GO:0048855 adenohypophysis morphogenesis biological_process
GO:0048856 anatomical structure development biological_process
GO:0033505 floor plate morphogenesis biological_process
GO:0048598 embryonic morphogenesis biological_process
GO:0044249 cellular biosynthetic process biological_process
GO:0009952 anterior/posterior pattern specification biological_process
GO:0009953 dorsal/ventral pattern formation biological_process
GO:0044271 cellular nitrogen compound biosynthetic process biological_process
GO:0021953 central nervous system neuron differentiation biological_process
GO:0003002 regionalization biological_process
GO:0007389 pattern specification process biological_process
GO:0007399 nervous system development biological_process
GO:0021983 pituitary gland development biological_process
GO:0021984 adenohypophysis development biological_process
GO:0002181 cytoplasmic translation biological_process
GO:0032502 developmental process biological_process
GO:0002183 cytoplasmic translational initiation biological_process
GO:0007417 central nervous system development biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0007418 ventral midline development biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:0007420 brain development biological_process
GO:0030900 forebrain development biological_process
GO:0022008 neurogenesis biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0048699 generation of neurons biological_process
GO:0021508 floor plate formation biological_process
GO:0021510 spinal cord development biological_process
GO:0060322 head development biological_process
GO:0009790 embryo development biological_process
GO:0021517 ventral spinal cord development biological_process
GO:0051960 regulation of nervous system development biological_process
GO:0051961 negative regulation of nervous system development biological_process
GO:0005852 eukaryotic translation initiation factor 3 complex cellular_component
GO:0033290 eukaryotic 48S preinitiation complex cellular_component
GO:0016282 eukaryotic 43S preinitiation complex cellular_component
GO:0070993 translation preinitiation complex cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0008135 translation factor activity, RNA binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding molecular_function
GO:0000987 cis-regulatory region sequence-specific DNA binding molecular_function
GO:0003743 translation initiation factor activity molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

Ensembl:

ensembl_id ENSDART00000142332

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00031111 lncRNA upstream 140469 31944773 ~ 31948762 (+) False XLOC_015565
TCONS_00031106 lncRNA upstream 140776 31942390 ~ 31948455 (+) False XLOC_015565
TCONS_00033558 lncRNA upstream 220476 31866499 ~ 31868755 (+) True XLOC_015564
TCONS_00031101 lncRNA upstream 302949 31784012 ~ 31786282 (+) True XLOC_015559
TCONS_00033557 lncRNA upstream 548641 31537338 ~ 31540590 (+) True XLOC_015554
TCONS_00033583 lncRNA downstream 57140 32149121 ~ 32188991 (+) True XLOC_015568
TCONS_00033584 lncRNA downstream 172374 32264355 ~ 32266672 (+) True XLOC_015569
TCONS_00033585 lncRNA downstream 293707 32385688 ~ 32390974 (+) False XLOC_015570
TCONS_00033586 lncRNA downstream 295298 32387279 ~ 32390974 (+) True XLOC_015570
TCONS_00033587 lncRNA downstream 512886 32604867 ~ 32608027 (+) True XLOC_015571
TCONS_00031114 mRNA upstream 70860 32016256 ~ 32018371 (+) False XLOC_015566
TCONS_00031115 mRNA upstream 71637 32016516 ~ 32017594 (+) True XLOC_015566
TCONS_00031112 mRNA upstream 79515 31948352 ~ 32009716 (+) False XLOC_015565
TCONS_00031113 mRNA upstream 82919 31957554 ~ 32006312 (+) True XLOC_015565
TCONS_00031108 mRNA upstream 137230 31942426 ~ 31952001 (+) False XLOC_015565
TCONS_00031121 mRNA downstream 651826 32743807 ~ 32756706 (+) True XLOC_015575
TCONS_00031123 mRNA downstream 688157 32780138 ~ 32790887 (+) False XLOC_015577
TCONS_00031125 mRNA downstream 704892 32796873 ~ 32799083 (+) True XLOC_015578
TCONS_00031126 mRNA downstream 734254 32826235 ~ 32834441 (+) False XLOC_015579
TCONS_00031128 mRNA downstream 743698 32835679 ~ 32838894 (+) True XLOC_015580
TCONS_00031110 other upstream 140776 31942459 ~ 31948455 (+) False XLOC_015565
TCONS_00031085 other upstream 744035 31330923 ~ 31345196 (+) True XLOC_015548
TCONS_00031082 other upstream 758273 31271082 ~ 31330958 (+) False XLOC_015548
TCONS_00031079 other upstream 980817 31107929 ~ 31108414 (+) True XLOC_015547
TCONS_00031078 other upstream 987658 31101088 ~ 31101573 (+) True XLOC_015546
TCONS_00031118 other downstream 512866 32604847 ~ 32608027 (+) False XLOC_015571
TCONS_00031119 other downstream 609839 32701820 ~ 32703332 (+) False XLOC_015574
TCONS_00031120 other downstream 609870 32701851 ~ 32707411 (+) True XLOC_015574
TCONS_00031122 other downstream 666682 32758663 ~ 32760332 (+) True XLOC_015576
TCONS_00031124 other downstream 698382 32790363 ~ 32790886 (+) True XLOC_015577

Expression Profile


//