RNA id: TCONS_00035590


Basic Information

Item Value
RNA id TCONS_00035590
length 379
RNA type processed_transcript
GC content 0.44
exon number 2
gene id XLOC_018061
representative True

Chromosome Information

Item Value
chromosome id NC_007131.7
NCBI id CM002904.2
chromosome length 55201332
location 23203946 ~ 23226453 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GCACTCAGATGCGTCAAGTAAGTACAATAGTACGTTTTCACTGCTTTTCGTTTTCTGTCGAGCTGTGATGACAATTGCGTGCTTGCTGCATCCTGACAAGTCGCCGTGACTTCTTTTAAGATGTATGATTCGCTGTGTTGACGCATTTTGTGAGTAAAGTAGCCGTTACCGGAGCATACAGATCACCAGATTGACTCTGAGCTTGCTAGCTGCTCTCTTTGTGTAATTACTCCGATGTTTTGGGCGCTTGCAAGAGACAACGACCTTCGTTGATTATCGTTGCATTTTAGCATTCTGTGCTTGAGTATATACAGCAATCCGAACAAGATTTCCAGCTGAACTCTCATTTGTCCACACTGGCCAGTATCCACAAAATCTA

Function

GO:

id name namespace
GO:0045116 protein neddylation biological_process
GO:0051443 positive regulation of ubiquitin-protein transferase activity biological_process
GO:0000151 ubiquitin ligase complex cellular_component
GO:0097602 cullin family protein binding molecular_function
GO:0031624 ubiquitin conjugating enzyme binding molecular_function
GO:0032182 ubiquitin-like protein binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-041014-248 Predicted to enable cullin family protein binding activity; ubiquitin conjugating enzyme binding activity; and ubiquitin-like protein binding activity. Predicted to be involved in positive regulation of protein neddylation; positive regulation of ubiquitin-protein transferase activity; and protein neddylation. Predicted to be located in nucleus. Predicted to be part of ubiquitin ligase complex. Orthologous to human DCUN1D4 (defective in cullin neddylation 1 domain containing 4).

Ensembl:

ensembl_id ENSDART00000153308

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00036473 lncRNA downstream 27242 23194788 ~ 23196658 (-) True XLOC_018060
TCONS_00036472 lncRNA downstream 52541 23169183 ~ 23171359 (-) True XLOC_018059
TCONS_00036835 lncRNA downstream 54932 23160676 ~ 23168968 (-) False XLOC_018059
TCONS_00035585 lncRNA downstream 60322 23160676 ~ 23163578 (-) False XLOC_018059
TCONS_00035584 lncRNA downstream 60326 23160676 ~ 23163574 (-) False XLOC_018059
TCONS_00035600 lncRNA upstream 254077 23480453 ~ 23488144 (-) False XLOC_018066
TCONS_00036836 lncRNA upstream 682218 23908594 ~ 23946098 (-) True XLOC_018071
TCONS_00035610 lncRNA upstream 838313 24064689 ~ 24122757 (-) False XLOC_018072
TCONS_00035615 lncRNA upstream 926302 24152678 ~ 24159764 (-) False XLOC_018073
TCONS_00035617 lncRNA upstream 945292 24171668 ~ 24181988 (-) False XLOC_018073
TCONS_00035589 mRNA downstream 3936 23206134 ~ 23219964 (-) False XLOC_018061
TCONS_00035583 mRNA downstream 52470 23160512 ~ 23171430 (-) False XLOC_018059
TCONS_00035578 mRNA downstream 182625 22869608 ~ 23041275 (-) True XLOC_018053
TCONS_00035580 mRNA downstream 197677 23022985 ~ 23026223 (-) True XLOC_018055
TCONS_00035576 mRNA downstream 425106 22739792 ~ 22798794 (-) False XLOC_018052
TCONS_00035591 mRNA upstream 19244 23245620 ~ 23253630 (-) False XLOC_018062
TCONS_00035592 mRNA upstream 19244 23245620 ~ 23254876 (-) False XLOC_018062
TCONS_00035594 mRNA upstream 197438 23423814 ~ 23426339 (-) False XLOC_018063
TCONS_00035596 mRNA upstream 205109 23431485 ~ 23439011 (-) False XLOC_018064
TCONS_00035597 mRNA upstream 205517 23431893 ~ 23440955 (-) True XLOC_018064
TCONS_00035586 other downstream 60643 23161279 ~ 23163257 (-) False XLOC_018059
TCONS_00035582 other downstream 141710 23082069 ~ 23082190 (-) False XLOC_018056
TCONS_00035581 other downstream 142104 23081660 ~ 23081796 (-) True XLOC_018057
TCONS_00035579 other downstream 313588 22910198 ~ 22910312 (-) True XLOC_018054
TCONS_00035566 other downstream 1313766 21897971 ~ 21910134 (-) True XLOC_018042
TCONS_00035593 other upstream 19263 23245639 ~ 23248639 (-) True XLOC_018062
TCONS_00035595 other upstream 197470 23423846 ~ 23425654 (-) True XLOC_018063
TCONS_00035611 other upstream 856763 24083139 ~ 24122757 (-) True XLOC_018072
TCONS_00035616 other upstream 926423 24152799 ~ 24172140 (-) False XLOC_018073
TCONS_00035626 other upstream 2142134 25368510 ~ 25369880 (-) False XLOC_018081

Expression Profile

//