RNA id: TCONS_00038639


Basic Information

Item Value
RNA id TCONS_00038639
length 323
RNA type mRNA
GC content 0.43
exon number 3
gene id XLOC_019621
representative True

Chromosome Information

Item Value
chromosome id NC_007132.7
NCBI id CM002905.2
chromosome length 45934066
location 25676097 ~ 25685768 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GTCAAGTCTTCTGGGCAGAGAACTGGAGCACAATTAAAGGCTGTATAAAGAAACGACAAAAATAATCAACTTCTGAAGCGGTTTGTTCTTGGAGGTGTTGTTTATGAGCGTCGTCTGTTGTTATGAGCTACAACTGAGGCATAAAAAGGTTACTGAAGGACGAACGGCTAGCACGTCCAATTCATCAGAATGACAAAAGAAGAGGAAAACCCTGACTGGGTTGGTGGACAAGAATTTTATGACAAATATGATCCAAAGGAGATCTTGGGAAGGGGTGTGAGCAGTGTAGTTCGCAGATGTGTGGATAAACGGACTGGTCAGGA

Function

GO:

id name namespace
GO:0042770 signal transduction in response to DNA damage biological_process
GO:0044773 mitotic DNA damage checkpoint biological_process
GO:0006468 protein phosphorylation biological_process
GO:0005978 glycogen biosynthetic process biological_process
GO:0016310 phosphorylation biological_process
GO:0005634 nucleus cellular_component
GO:0005964 phosphorylase kinase complex cellular_component
GO:0005737 cytoplasm cellular_component
GO:0016740 transferase activity molecular_function
GO:0005516 calmodulin binding molecular_function
GO:0005524 ATP binding molecular_function
GO:0000166 nucleotide binding molecular_function
GO:0004672 protein kinase activity molecular_function
GO:0004674 protein serine/threonine kinase activity molecular_function
GO:0004689 phosphorylase kinase activity molecular_function
GO:0016301 kinase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-050522-52 Predicted to enable protein serine/threonine kinase activity. Predicted to be involved in mitotic DNA damage checkpoint signaling. Predicted to act upstream of or within glycogen biosynthetic process and protein phosphorylation. Predicted to be part of phosphorylase kinase complex. Predicted to be active in cytoplasm and nucleus. Orthologous to human PHKG1 (phosphorylase kinase catalytic subunit gamma 1).

Ensembl:

ensembl_id ENSDART00000129619

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00038628 lncRNA downstream 83532 25599088 ~ 25601609 (-) True XLOC_019616
TCONS_00038626 lncRNA downstream 87564 25595716 ~ 25597577 (-) False XLOC_019616
TCONS_00038612 lncRNA downstream 307130 25376752 ~ 25378011 (-) True XLOC_019609
TCONS_00039645 lncRNA downstream 458253 25221951 ~ 25226888 (-) True XLOC_019606
TCONS_00039644 lncRNA downstream 462621 25218897 ~ 25222520 (-) False XLOC_019606
TCONS_00039646 lncRNA upstream 61437 25747176 ~ 25748927 (-) True XLOC_019624
TCONS_00038648 lncRNA upstream 110599 25796338 ~ 25799633 (-) True XLOC_019627
TCONS_00038652 lncRNA upstream 381271 26067010 ~ 26067893 (-) True XLOC_019629
TCONS_00039647 lncRNA upstream 565637 26251376 ~ 26255052 (-) False XLOC_019633
TCONS_00039648 lncRNA upstream 565637 26251376 ~ 26395229 (-) False XLOC_019633
TCONS_00038636 mRNA downstream 15321 25664393 ~ 25669820 (-) True XLOC_019620
TCONS_00038635 mRNA downstream 16988 25664393 ~ 25668153 (-) False XLOC_019620
TCONS_00038633 mRNA downstream 61799 25620209 ~ 25623342 (-) False XLOC_019619
TCONS_00038632 mRNA downstream 66966 25614427 ~ 25618175 (-) True XLOC_019618
TCONS_00038631 mRNA downstream 72483 25605574 ~ 25612658 (-) True XLOC_019617
TCONS_00038641 mRNA upstream 18585 25704324 ~ 25722834 (-) True XLOC_019622
TCONS_00038642 mRNA upstream 53556 25739295 ~ 25741411 (-) False XLOC_019623
TCONS_00038643 mRNA upstream 54706 25740445 ~ 25741096 (-) True XLOC_019623
TCONS_00038644 mRNA upstream 61324 25747063 ~ 25748913 (-) False XLOC_019624
TCONS_00038645 mRNA upstream 68529 25754268 ~ 25756119 (-) True XLOC_019625
TCONS_00038634 other downstream 59958 25620405 ~ 25625183 (-) True XLOC_019619
TCONS_00038630 other downstream 71944 25605533 ~ 25613197 (-) False XLOC_019617
TCONS_00038618 other downstream 221777 25452590 ~ 25463364 (-) True XLOC_019612
TCONS_00038597 other downstream 1938194 23552023 ~ 23746947 (-) True XLOC_019599
TCONS_00038595 other downstream 2269126 23409087 ~ 23416015 (-) False XLOC_019599
TCONS_00038640 other upstream 17339 25703078 ~ 25722792 (-) False XLOC_019622
TCONS_00038657 other upstream 467103 26152842 ~ 26170837 (-) True XLOC_019632
TCONS_00038671 other upstream 1016082 26701821 ~ 26701954 (-) True XLOC_019643
TCONS_00038674 other upstream 1232189 26917928 ~ 26918903 (-) True XLOC_019646
TCONS_00038689 other upstream 1519260 27204999 ~ 27221304 (-) False XLOC_019652

Expression Profile

//