RNA id: TCONS_00053851



Basic Information


Item Value
RNA id TCONS_00053851
length 680
RNA type processed_transcript
GC content 0.43
exon number 4
gene id XLOC_027369
representative False

Chromosome Information


Item Value
chromosome id NC_007115.7
NCBI id CM002888.2
chromosome length 78093715
location 27100528 ~ 27109748 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


CTTTAAAAGAAGAACGCGCGATGGCTCGCAAGGAAGCTGTAAATGAGAGCTGTCTCCTAATTTTCATGATCAGTATATCATTGCTACATTTGTTTACTTGTCCCTACACCAAAGTTGAAGAAAGCTTTAATTTACAAGCAATTCATGATATTCTGTATCACAGATTTGATTTTGAAAAGTTCTTCTGGCATTCACCTCTTGGCTGGCCCAGAGACATGGCGCATTCATTTGGCTTTCTGCCTTGGCAGCTATTGTGTTTCGTTCTGAACTGTGTCTCTTCTTTGGCCTGATGTTGCTGATGTCACTTTTGAATAGAAAACTCAATTTTGGACAGTTGCTTTACCATGCTATACCTGCTGGTTTTGTATCGTTGGGTCTCACTATCATGTTTGACAGCCTTTTCTGGAATAAGCTGCTTTGGCCTGAGGGTCAGGTATTGTGGTACAACACAGTCTTGAATACTTCCCCTTTTCTTTGGTATTTCTACTCCGCTCTCCCTCGAGCTCTTGCCAGCACAATACTTTTTATCCCACTTGGCCTTTTGGACAGACGGACAAGAAAGCTGCTCGTTGTATCCATAGGTTTCATTCTGCTGTACTCCCTTTTGCCCCATAAGGAACTTCGTTTTATCATCTACACCTTCCCTGTATTCAACGTGATTGGTGCCTGTGGCTGTTCCT

Function


GO:

id name namespace
GO:0006487 protein N-linked glycosylation biological_process
GO:0006488 dolichol-linked oligosaccharide biosynthetic process biological_process
GO:0005783 endoplasmic reticulum cellular_component
GO:0005788 endoplasmic reticulum lumen cellular_component
GO:0005789 endoplasmic reticulum membrane cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0000009 alpha-1,6-mannosyltransferase activity molecular_function
GO:0000030 mannosyltransferase activity molecular_function
GO:0016740 transferase activity molecular_function
GO:0016757 transferase activity, transferring glycosyl groups molecular_function
GO:0052824 dolichyl-pyrophosphate Man7GlcNAc2 alpha-1,6-mannosyltransferase activity molecular_function

KEGG:

id description
ko00510 N-Glycan biosynthesis
ko00513 Various types of N-glycan biosynthesis
ko01003 Glycosyltransferases

ZFIN:

id description
ZDB-GENE-041210-295 Predicted to enable alpha-1,6-mannosyltransferase activity. Predicted to be involved in protein N-linked glycosylation. Predicted to act upstream of or within dolichol-linked oligosaccharide biosynthetic process. Predicted to be located in endoplasmic reticulum. Predicted to be active in endoplasmic reticulum membrane. Human ortholog(s) of this gene implicated in congenital disorder of glycosylation Ig. Orthologous to human ALG12 (ALG12 alpha-1,6-mannosyltransferase).

Ensembl:

ensembl_id ENSDART00000141908

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00057737 lncRNA upstream 263853 26831255 ~ 26836675 (+) True XLOC_027366
TCONS_00053841 lncRNA upstream 527872 26496503 ~ 26572656 (+) False XLOC_027364
TCONS_00053838 lncRNA upstream 741077 26357467 ~ 26359451 (+) True XLOC_027362
TCONS_00057736 lncRNA upstream 1345179 25754037 ~ 25755349 (+) True XLOC_027357
TCONS_00057735 lncRNA upstream 2010681 25084095 ~ 25089847 (+) True XLOC_027345
TCONS_00053863 lncRNA downstream 1257756 28364263 ~ 28371438 (+) True XLOC_027373
TCONS_00057738 lncRNA downstream 1526740 28633247 ~ 28635544 (+) True XLOC_027378
TCONS_00057739 lncRNA downstream 1586759 28693266 ~ 28710065 (+) False XLOC_027379
TCONS_00057740 lncRNA downstream 1856267 28962774 ~ 28963359 (+) False XLOC_027430
TCONS_00057154 lncRNA downstream 1980506 29087013 ~ 29088974 (+) True XLOC_027432
TCONS_00053848 mRNA upstream 20669 26972862 ~ 27079859 (+) False XLOC_027367
TCONS_00053849 mRNA upstream 25304 26972979 ~ 27075224 (+) True XLOC_027367
TCONS_00053850 mRNA upstream 77803 27018663 ~ 27022725 (+) True XLOC_027368
TCONS_00053846 mRNA upstream 334173 26628822 ~ 26766355 (+) False XLOC_027364
TCONS_00053840 mRNA upstream 336973 26496489 ~ 26763555 (+) False XLOC_027364
TCONS_00053855 mRNA downstream 23905 27130412 ~ 27147897 (+) False XLOC_027370
TCONS_00053856 mRNA downstream 25218 27131725 ~ 27150414 (+) True XLOC_027370
TCONS_00053857 mRNA downstream 792326 27898833 ~ 27953778 (+) True XLOC_027371
TCONS_00053859 mRNA downstream 1248551 28355058 ~ 28360129 (+) False XLOC_027373
TCONS_00053860 mRNA downstream 1250099 28356606 ~ 28373257 (+) False XLOC_027373
TCONS_00053842 other upstream 529715 26570698 ~ 26570813 (+) True XLOC_027365
TCONS_00053811 other upstream 1491017 25607102 ~ 25609511 (+) False XLOC_027351
TCONS_00053789 other upstream 3721150 23379262 ~ 23379378 (+) True XLOC_027338
TCONS_00053784 other upstream 3965992 23132542 ~ 23134536 (+) False XLOC_027335
TCONS_00053781 other upstream 3968004 23127204 ~ 23132524 (+) False XLOC_027335
TCONS_00053858 other downstream 1009100 28115607 ~ 28115721 (+) True XLOC_027372
TCONS_00053865 other downstream 1277930 28384437 ~ 28407131 (+) True XLOC_027375
TCONS_00053868 other downstream 1335755 28442262 ~ 28498065 (+) False XLOC_027377
TCONS_00053872 other downstream 1586864 28693371 ~ 28693443 (+) False XLOC_027379
TCONS_00053873 other downstream 1587121 28693628 ~ 28693708 (+) False XLOC_027379

Expression Profile


//