RNA id: TCONS_00062321


Basic Information

Item Value
RNA id TCONS_00062321
length 487
RNA type processed_transcript
GC content 0.47
exon number 2
gene id XLOC_031815
representative True

Chromosome Information

Item Value
chromosome id NC_007117.7
NCBI id CM002890.2
chromosome length 60270059
location 6822592 ~ 6845993 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TTGTGTTGGGTGTGTTTGTATGGGATTTCTGAATCAGCTTTCTGAAATGCTCGTCTGAGTTAGCTAAATTCAGTAGGACTGAGGGCGACAGAAGCGAACTGACTCTTCATTCAACCTGGCTGTAACTAAATATAGCCACACACTCTCAAACTTGCATGAGTGCTGACGACAAGTGGTGGTCGATGGTAGGAATCCGGAGCGGGATTCTGGGAATGTTCTTTAAACCAACAACACAGGACATTTTCTGCCCCTGGCAGTCTTCTAGTTCAGGGCAGGACATCGATCTGTATAGAGGGCACCTGCTCTGATGTATTACCGGGAGAGGATCAAACTTGCAGCCCAACTGGGAATCTAATCCCTCCATTGACCGACAACAGCCCTAATGCCTCCAAAGGTGAAAGTAGTAGTGCCCTGTCTTTTATAAACCCAACTTTCCTCAAGACACAGCAAGATCTCAGTCAAAATGCAGCAACTGTGATCACTGACG

Function

GO:

id name namespace
GO:0007165 signal transduction biological_process

KEGG: NA

ZFIN:

id description
ZDB-GENE-090312-194 Predicted to enable GTPase activator activity. Predicted to act upstream of or within signal transduction. Orthologous to human RIN2 (Ras and Rab interactor 2).

Ensembl:

ensembl_id ENSDART00000151343

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00062317 lncRNA upstream 23706 6802528 ~ 6808340 (+) False XLOC_031814
TCONS_00062315 lncRNA upstream 31788 6799291 ~ 6800258 (+) True XLOC_031813
TCONS_00062313 lncRNA upstream 38870 6789659 ~ 6793176 (+) True XLOC_031812
TCONS_00064805 lncRNA upstream 43103 6786638 ~ 6788943 (+) False XLOC_031812
TCONS_00062312 lncRNA upstream 43103 6787035 ~ 6788943 (+) False XLOC_031812
TCONS_00062325 lncRNA downstream 61607 6894228 ~ 6900683 (+) True XLOC_031816
TCONS_00064806 lncRNA downstream 374972 7207593 ~ 7208629 (+) True XLOC_031820
TCONS_00062339 lncRNA downstream 596690 7429311 ~ 7435700 (+) True XLOC_031826
TCONS_00062351 lncRNA downstream 818106 7650727 ~ 7652412 (+) True XLOC_031831
TCONS_00062354 lncRNA downstream 1257802 8090423 ~ 8093799 (+) False XLOC_031833
TCONS_00062318 mRNA upstream 22448 6802582 ~ 6809598 (+) True XLOC_031814
TCONS_00062316 mRNA upstream 23536 6802142 ~ 6808510 (+) False XLOC_031814
TCONS_00062314 mRNA upstream 31659 6797520 ~ 6800387 (+) False XLOC_031813
TCONS_00062310 mRNA upstream 35359 6780873 ~ 6796687 (+) False XLOC_031812
TCONS_00062309 mRNA upstream 36050 6779114 ~ 6795996 (+) False XLOC_031812
TCONS_00062322 mRNA downstream 18200 6850821 ~ 6922290 (+) False XLOC_031816
TCONS_00062323 mRNA downstream 18232 6850853 ~ 6922290 (+) False XLOC_031816
TCONS_00062326 mRNA downstream 92016 6924637 ~ 6962195 (+) False XLOC_031818
TCONS_00062327 mRNA downstream 92016 6924637 ~ 6967588 (+) True XLOC_031818
TCONS_00062328 mRNA downstream 291359 7123980 ~ 7132026 (+) False XLOC_031819
TCONS_00062305 other upstream 558569 6271867 ~ 6273477 (+) True XLOC_031808
TCONS_00062300 other upstream 616136 6215794 ~ 6215910 (+) True XLOC_031807
TCONS_00062297 other upstream 1147751 5684181 ~ 5684295 (+) True XLOC_031803
TCONS_00062276 other upstream 2981804 3834442 ~ 3850242 (+) True XLOC_031788
TCONS_00062273 other upstream 2993818 3827777 ~ 3838228 (+) False XLOC_031788
TCONS_00062324 other downstream 47306 6879927 ~ 6880049 (+) True XLOC_031817
TCONS_00062341 other downstream 620734 7453355 ~ 7453831 (+) True XLOC_031828
TCONS_00062343 other downstream 633652 7466273 ~ 7472497 (+) False XLOC_031829
TCONS_00062345 other downstream 667507 7500128 ~ 7505016 (+) False XLOC_031829
TCONS_00062355 other downstream 1257956 8090577 ~ 8093799 (+) True XLOC_031833

Expression Profile

//