RNA id: TCONS_00071219


Basic Information

Item Value
RNA id TCONS_00071219
length 657
RNA type mRNA
GC content 0.53
exon number 5
gene id XLOC_036438
representative True

Chromosome Information

Item Value
chromosome id NC_007119.7
NCBI id CM002892.2
chromosome length 54304671
location 23753273 ~ 23776399 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TCAAAGCTAAAGATTGAACTGTTATACTGTTGAGCAACTGCAGAATAAGGAAAATGAGCATGGATTGTAAAGAGGAGATCAGTGACTCTGACAGCGGGATTATTTTGAACTCTGGTCCAGACAGTCCCACATCTCCAGTGAAGGAGCTGAACACTCACACAAGGGCCATGAGGCTAAAGCAGCAGGCGCTGGAGGACCGGCTGGAGCTCTGTGTGCTGGAGCTGAAGAAACTCTGCATCCGAGAGGCCGAGCTGACTGGAAAACTGCCCTCTGATTACCCTCTCCTGCCTGACGAGAAGCCGCCGCAGGTCCGGCGACGCATCGGAGCAGCTTTTAAACTGGATGAGGGCTTTATTTCACAAGATGGAGAGGAGTCTGAGCTGCTTTCGCTGGAGGCTGATCTCGCCCTGCAGCGGCAGATTTATGAGGCAGCGCGAAAGCTCTCCCTGGAGGAGCACATCAGCAAACCGGTAAGGAAAAGCCGACTGCAGCAGTGCAAACGTGAGGAGAAGAAGCTAAAAGAACTGCAGGTTGCCATACTGAAACACCGCATCAACCACGGCTGTGTTTCTCCTCAAACCTGCTATTCGTCCAGGCAGAGAGATCTTTGCATGTCTGACGACAGCTCGCTCTCTGACGCTGTTGCCTTGGATGATG

Function

GO:

id name namespace
GO:0045087 innate immune response biological_process
GO:0031398 positive regulation of protein ubiquitination biological_process
GO:0034334 adherens junction maintenance biological_process

KEGG: NA

ZFIN:

id description
ZDB-GENE-081105-161 Predicted to be involved in adherens junction maintenance and positive regulation of protein ubiquitination. Predicted to act upstream of or within innate immune response. Predicted to be located in cytoplasm. Human ortholog(s) of this gene implicated in inflammatory bowel disease 29. Orthologous to human INAVA (innate immunity activator).

Ensembl:

ensembl_id ENSDART00000141871

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00072456 lncRNA downstream 54632 23688651 ~ 23705867 (-) False XLOC_036437
TCONS_00071211 lncRNA downstream 176288 23581510 ~ 23584211 (-) False XLOC_036436
TCONS_00071212 lncRNA downstream 176644 23581510 ~ 23583855 (-) False XLOC_036436
TCONS_00072455 lncRNA downstream 202577 23554027 ~ 23557922 (-) True XLOC_036434
TCONS_00071206 lncRNA downstream 370257 23387884 ~ 23390242 (-) True XLOC_036432
TCONS_00071223 lncRNA upstream 17416 23782623 ~ 23783597 (-) True XLOC_036440
TCONS_00072043 lncRNA upstream 427492 24192699 ~ 24215822 (-) True XLOC_036444
TCONS_00072457 lncRNA upstream 532164 24297371 ~ 24297670 (-) True XLOC_036446
TCONS_00072458 lncRNA upstream 560041 24325248 ~ 24577568 (-) True XLOC_036447
TCONS_00072459 lncRNA upstream 654743 24419950 ~ 24497994 (-) True XLOC_036450
TCONS_00071217 mRNA downstream 2187 23753273 ~ 23758312 (-) False XLOC_036438
TCONS_00071215 mRNA downstream 58204 23672254 ~ 23702295 (-) False XLOC_036437
TCONS_00071216 mRNA downstream 58619 23689992 ~ 23701880 (-) True XLOC_036437
TCONS_00071214 mRNA downstream 75840 23672254 ~ 23684659 (-) False XLOC_036437
TCONS_00071210 mRNA downstream 148037 23579974 ~ 23612462 (-) False XLOC_036436
TCONS_00071220 mRNA upstream 11363 23776570 ~ 23780402 (-) False XLOC_036439
TCONS_00071221 mRNA upstream 11571 23776778 ~ 23780334 (-) True XLOC_036439
TCONS_00071222 mRNA upstream 15821 23781028 ~ 23783633 (-) False XLOC_036440
TCONS_00071224 mRNA upstream 111721 23876928 ~ 23885016 (-) False XLOC_036441
TCONS_00071225 mRNA upstream 116704 23881911 ~ 23884312 (-) True XLOC_036441
TCONS_00071202 other downstream 637625 23122762 ~ 23122874 (-) True XLOC_036425
TCONS_00071201 other downstream 638127 23122151 ~ 23122372 (-) False XLOC_036425
TCONS_00071194 other downstream 914701 22844700 ~ 22845798 (-) True XLOC_036420
TCONS_00071192 other downstream 977277 22766456 ~ 22783222 (-) False XLOC_036419
TCONS_00071180 other downstream 1221549 22536028 ~ 22538950 (-) True XLOC_036416
TCONS_00071249 other upstream 1277994 25043201 ~ 25044808 (-) True XLOC_036463
TCONS_00071268 other upstream 1885022 25650229 ~ 25665761 (-) False XLOC_036471
TCONS_00071278 other upstream 1986918 25752125 ~ 25755298 (-) False XLOC_036475
TCONS_00071280 other upstream 1991475 25756682 ~ 25761038 (-) False XLOC_036475
TCONS_00071284 other upstream 2053415 25818622 ~ 25846188 (-) False XLOC_036477

Expression Profile

//